Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135185564:

Variant ID: vg0135185564 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 35185564
Reference Allele: A	Alternative Allele: AAC
Primary Allele: AAC	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCTTCCCATACCAAATACGAGTAGTGGTTCAGACGTCATAAAGGTGAAGGAAAAATCCGGGTATCCTTACGAATGGCAGTACAGAAATGTGCATGTGA[A/AAC]
AAATACTTTCTATCTTCGTTTATCTTTCGAGAAAAGAAAGGGCGCAATTTGAGTTGGAATTGGAGGGGATTACATTGGACTGAAGCTCGTATGCACAGTT

Reverse complement sequence

AACTGTGCATACGAGCTTCAGTCCAATGTAATCCCCTCCAATTCCAACTCAAATTGCGCCCTTTCTTTTCTCGAAAGATAAACGAAGATAGAAAGTATTT[T/GTT]
TCACATGCACATTTCTGTACTGCCATTCGTAAGGATACCCGGATTTTTCCTTCACCTTTATGACGTCTGAACCACTACTCGTATTTGGTATGGGAAGGAA

Allele Frequencies:

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.