Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0124857385:

Variant ID: vg0124857385 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 24857385
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGTTCACCAGCGCCGCCGACGACGACGAGTCCGGCACCACCACCGTGAACTCCCCCCTGCACACCGCAACCAGCACCGCCACGACGGCCACCACCACCG[T/C]
CGCCGCCGCCGTCGCGGAGAGCGCAGAGGCCACCATATCACCTTGCACGCTCGTGCGACGCGATGCGCTCGGAAGGGTCACGACCGTTGGGAATTTGGAG

Reverse complement sequence

CTCCAAATTCCCAACGGTCGTGACCCTTCCGAGCGCATCGCGTCGCACGAGCGTGCAAGGTGATATGGTGGCCTCTGCGCTCTCCGCGACGGCGGCGGCG[A/G]
CGGTGGTGGTGGCCGTCGTGGCGGTGCTGGTTGCGGTGTGCAGGGGGGAGTTCACGGTGGTGGTGCCGGACTCGTCGTCGTCGGCGGCGCTGGTGAACGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.70%	26.30%	0.02%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	22.30%	77.70%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	1.60%	98.40%	0.00%	0.00%	NA
Tropical Japonica	504	55.60%	44.40%	0.00%	0.00%	NA
Japonica Intermediate	241	18.70%	81.30%	0.00%	0.00%	NA
VI/Aromatic	96	71.90%	28.10%	0.00%	0.00%	NA
Intermediate	90	72.20%	26.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0124857385	T -> C	LOC_Os01g43440.1	missense_variant ; p.Thr13Ala; MODERATE	nonsynonymous_codon ; T13A	Average:89.718; most accessible tissue: Minghui63 panicle, score: 96.207	unknown	unknown	TOLERATED	0.63

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0124857385	T	C	-0.01	0.0	-0.01	0.0	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0124857385	NA	1.90E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124857385	NA	1.79E-17	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124857385	NA	6.51E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124857385	NA	3.52E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124857385	NA	1.64E-16	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124857385	NA	5.10E-21	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124857385	NA	3.97E-39	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0124857385	NA	5.55E-45	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251