Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100924946:

Variant ID: vg0100924946 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 924946
Reference Allele: T	Alternative Allele: TCC
Primary Allele: T	Secondary Allele: TCC

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, TCC: 0.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTTCAAGAGATTTACCAAGAGATCAGCACGGTGTAGTTGGCCCAATAACTTGCCTCAGTAACAACGCAAGCCAGTGGTATTTGATACATCCTTATGCA[T/TCC]
ATTGTCTGTTCTTCAGCCAGACTGCAAAGTTGTTAGTAATGGCATCCAGGCACCCTCAACTTTTAAGGAAACAGAAAATGGAGTAATCGGTGTTGATGAG

Reverse complement sequence

CTCATCAACACCGATTACTCCATTTTCTGTTTCCTTAAAAGTTGAGGGTGCCTGGATGCCATTACTAACAACTTTGCAGTCTGGCTGAAGAACAGACAAT[A/GGA]
TGCATAAGGATGTATCAAATACCACTGGCTTGCGTTGTTACTGAGGCAAGTTATTGGGCCAACTACACCGTGCTGATCTCTTGGTAAATCTCTTGAACAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of TCC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.20%	0.80%	2.35%	31.63%	NA
All Indica	2759	74.40%	0.80%	2.03%	22.76%	NA
All Japonica	1512	51.20%	0.90%	2.71%	45.17%	NA
Aus	269	56.90%	1.10%	4.46%	37.55%	NA
Indica I	595	55.10%	3.00%	7.23%	34.62%	NA
Indica II	465	94.40%	0.00%	0.00%	5.59%	NA
Indica III	913	72.50%	0.00%	0.22%	27.27%	NA
Indica Intermediate	786	79.50%	0.40%	1.40%	18.70%	NA
Temperate Japonica	767	73.90%	0.70%	1.56%	23.86%	NA
Tropical Japonica	504	14.90%	1.60%	3.77%	79.76%	NA
Japonica Intermediate	241	54.80%	0.40%	4.15%	40.66%	NA
VI/Aromatic	96	38.50%	0.00%	0.00%	61.46%	NA
Intermediate	90	70.00%	1.10%	2.22%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0100924946	T -> TCC	LOC_Os01g02700.1	upstream_gene_variant ; 1317.0bp to feature; MODIFIER	silent_mutation	Average:69.147; most accessible tissue: Zhenshan97 flag leaf, score: 91.771	N	N	N	N
vg0100924946	T -> TCC	LOC_Os01g02720.1	downstream_gene_variant ; 4936.0bp to feature; MODIFIER	silent_mutation	Average:69.147; most accessible tissue: Zhenshan97 flag leaf, score: 91.771	N	N	N	N
vg0100924946	T -> TCC	LOC_Os01g02720.2	downstream_gene_variant ; 4936.0bp to feature; MODIFIER	silent_mutation	Average:69.147; most accessible tissue: Zhenshan97 flag leaf, score: 91.771	N	N	N	N
vg0100924946	T -> TCC	LOC_Os01g02710.1	intron_variant ; MODIFIER	silent_mutation	Average:69.147; most accessible tissue: Zhenshan97 flag leaf, score: 91.771	N	N	N	N
vg0100924946	T -> DEL	N	N	silent_mutation	Average:69.147; most accessible tissue: Zhenshan97 flag leaf, score: 91.771	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0100924946	T	TCC	0.06	0.07	0.05	0.11	0.11	0.11