Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226901534:

Variant ID: vg1226901534 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 26901534
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, T: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTAAAAAAATTAAAAAGACAAGTCACGTATAAAATATTAATCATGTTTTATCATCTAACAACAATGAAAATACGAATTATAAAAAAATTTCATATAAA[A/T]
TTTTTTTTGAAAAATTTCATACAACATGCAAACCTAGGGTTTGCCTTTTTTTAGGACGGAGGGAGTAGATCACAAGACACCTGGATATTAATGTGTGAAG

Reverse complement sequence

CTTCACACATTAATATCCAGGTGTCTTGTGATCTACTCCCTCCGTCCTAAAAAAAGGCAAACCCTAGGTTTGCATGTTGTATGAAATTTTTCAAAAAAAA[T/A]
TTTATATGAAATTTTTTTATAATTCGTATTTTCATTGTTGTTAGATGATAAAACATGATTAATATTTTATACGTGACTTGTCTTTTTAATTTTTTTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.30%	9.40%	8.70%	47.63%	NA
All Indica	2759	19.30%	0.70%	5.62%	74.37%	NA
All Japonica	1512	63.40%	27.40%	8.93%	0.20%	NA
Aus	269	4.80%	0.00%	39.03%	56.13%	NA
Indica I	595	54.60%	0.50%	10.25%	34.62%	NA
Indica II	465	4.50%	1.90%	4.73%	88.82%	NA
Indica III	913	8.40%	0.10%	3.94%	87.51%	NA
Indica Intermediate	786	14.00%	0.80%	4.58%	80.66%	NA
Temperate Japonica	767	42.60%	43.00%	14.34%	0.00%	NA
Tropical Japonica	504	91.10%	5.60%	3.17%	0.20%	NA
Japonica Intermediate	241	71.80%	23.70%	3.73%	0.83%	NA
VI/Aromatic	96	78.10%	0.00%	12.50%	9.38%	NA
Intermediate	90	44.40%	11.10%	4.44%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1226901534	A -> DEL	N	N	silent_mutation	Average:45.037; most accessible tissue: Zhenshan97 flower, score: 84.409	N	N	N	N
vg1226901534	A -> T	LOC_Os12g43363.1	upstream_gene_variant ; 621.0bp to feature; MODIFIER	silent_mutation	Average:45.037; most accessible tissue: Zhenshan97 flower, score: 84.409	N	N	N	N
vg1226901534	A -> T	LOC_Os12g43370.1	upstream_gene_variant ; 4743.0bp to feature; MODIFIER	silent_mutation	Average:45.037; most accessible tissue: Zhenshan97 flower, score: 84.409	N	N	N	N
vg1226901534	A -> T	LOC_Os12g43363.2	upstream_gene_variant ; 618.0bp to feature; MODIFIER	silent_mutation	Average:45.037; most accessible tissue: Zhenshan97 flower, score: 84.409	N	N	N	N
vg1226901534	A -> T	LOC_Os12g43363.3	upstream_gene_variant ; 621.0bp to feature; MODIFIER	silent_mutation	Average:45.037; most accessible tissue: Zhenshan97 flower, score: 84.409	N	N	N	N
vg1226901534	A -> T	LOC_Os12g43350-LOC_Os12g43363	intergenic_region ; MODIFIER	silent_mutation	Average:45.037; most accessible tissue: Zhenshan97 flower, score: 84.409	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1226901534	NA	3.47E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1226901534	NA	1.51E-13	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1226901534	NA	2.76E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226901534	NA	2.23E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226901534	NA	1.30E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226901534	1.42E-06	1.42E-06	mr1824	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226901534	NA	9.54E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226901534	NA	2.68E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251