Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226008690:

Variant ID: vg1226008690 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 26008690
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


TAACTCTATTTACTATAATTGTGGCAAGCCACACAAAGTGTGGCCAACAATTTGTTAACCATAACTATGGCAAACTTTGGCTAGCAAATGAGAGTATGAC[G/A]
CTTGGGCCAATGTGTTAATAAAGTGTGGCTTGACTCAACTGCGGCACGCAACCAAACACTAGTCTAAAAAATTGTGGCACGCTTAAAGTTTGGTGTGGCA

Reverse complement sequence

TGCCACACCAAACTTTAAGCGTGCCACAATTTTTTAGACTAGTGTTTGGTTGCGTGCCGCAGTTGAGTCAAGCCACACTTTATTAACACATTGGCCCAAG[C/T]
GTCATACTCTCATTTGCTAGCCAAAGTTTGCCATAGTTATGGTTAACAAATTGTTGGCCACACTTTGTGTGGCTTGCCACAATTATAGTAAATAGAGTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 45.00% 0.51% 0.40% NA
All Indica  2759 91.00% 7.90% 0.36% 0.69% NA
All Japonica  1512 0.70% 98.80% 0.53% 0.00% NA
Aus  269 1.50% 97.80% 0.74% 0.00% NA
Indica I  595 91.60% 8.10% 0.34% 0.00% NA
Indica II  465 94.20% 5.60% 0.00% 0.22% NA
Indica III  913 91.80% 6.00% 0.55% 1.64% NA
Indica Intermediate  786 87.80% 11.50% 0.38% 0.38% NA
Temperate Japonica  767 0.30% 99.10% 0.65% 0.00% NA
Tropical Japonica  504 1.20% 98.60% 0.20% 0.00% NA
Japonica Intermediate  241 0.80% 98.30% 0.83% 0.00% NA
VI/Aromatic  96 1.00% 94.80% 4.17% 0.00% NA
Intermediate  90 31.10% 68.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1226008690 G -> DEL N N silent_mutation Average:79.129; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N
vg1226008690 G -> A LOC_Os12g41950.1 upstream_gene_variant ; 275.0bp to feature; MODIFIER silent_mutation Average:79.129; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N
vg1226008690 G -> A LOC_Os12g41950-LOC_Os12g41956 intergenic_region ; MODIFIER silent_mutation Average:79.129; most accessible tissue: Zhenshan97 panicle, score: 88.888 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1226008690 G A -0.03 -0.01 -0.03 0.0 -0.05 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1226008690 NA 2.95E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 8.10E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 7.55E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 1.46E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 1.14E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 3.10E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 4.57E-14 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 4.30E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 4.93E-07 mr1134_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 2.51E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 1.25E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 1.15E-13 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 1.71E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 1.72E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 1.05E-07 1.65E-09 mr1672_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 2.41E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226008690 NA 2.27E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251