Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225988493:

Variant ID: vg1225988493 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 25988493
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.50, G: 0.50, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGGCCTGGGAGATTCGTGGAGCTCCAATAAAGTTCCTATCAATCGAGCGTGCCCATTAGTTCGATCCTACAACTAACAGCATATAAATAAACTTTTTA[G/C]
TAACAATCTAAGAGCAAAGTCAATAGCGAAAGTAAGTAGTACGAAATATTGGCTTTAGGGAAGCATGAATGGGTTTAATTGTTGCATGCATATGTGATCA

Reverse complement sequence

TGATCACATATGCATGCAACAATTAAACCCATTCATGCTTCCCTAAAGCCAATATTTCGTACTACTTACTTTCGCTATTGACTTTGCTCTTAGATTGTTA[C/G]
TAAAAAGTTTATTTATATGCTGTTAGTTGTAGGATCGAACTAATGGGCACGCTCGATTGATAGGAACTTTATTGGAGCTCCACGAATCTCCCAGGCCTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.70%	37.90%	0.11%	0.28%	NA
All Indica	2759	93.70%	5.90%	0.00%	0.47%	NA
All Japonica	1512	0.70%	99.00%	0.26%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	87.10%	12.30%	0.00%	0.67%	NA
Indica II	465	94.80%	4.50%	0.00%	0.65%	NA
Indica III	913	97.50%	2.40%	0.00%	0.11%	NA
Indica Intermediate	786	93.50%	5.90%	0.00%	0.64%	NA
Temperate Japonica	767	0.10%	99.60%	0.26%	0.00%	NA
Tropical Japonica	504	1.40%	98.40%	0.20%	0.00%	NA
Japonica Intermediate	241	1.20%	98.30%	0.41%	0.00%	NA
VI/Aromatic	96	16.70%	83.30%	0.00%	0.00%	NA
Intermediate	90	42.20%	56.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1225988493	G -> C	LOC_Os12g41920.1	upstream_gene_variant ; 506.0bp to feature; MODIFIER	silent_mutation	Average:61.555; most accessible tissue: Callus, score: 83.08	N	N	N	N
vg1225988493	G -> C	LOC_Os12g41930.1	upstream_gene_variant ; 1571.0bp to feature; MODIFIER	silent_mutation	Average:61.555; most accessible tissue: Callus, score: 83.08	N	N	N	N
vg1225988493	G -> C	LOC_Os12g41920.2	upstream_gene_variant ; 506.0bp to feature; MODIFIER	silent_mutation	Average:61.555; most accessible tissue: Callus, score: 83.08	N	N	N	N
vg1225988493	G -> C	LOC_Os12g41920.3	upstream_gene_variant ; 506.0bp to feature; MODIFIER	silent_mutation	Average:61.555; most accessible tissue: Callus, score: 83.08	N	N	N	N
vg1225988493	G -> C	LOC_Os12g41930.2	upstream_gene_variant ; 1571.0bp to feature; MODIFIER	silent_mutation	Average:61.555; most accessible tissue: Callus, score: 83.08	N	N	N	N
vg1225988493	G -> C	LOC_Os12g41930.3	upstream_gene_variant ; 1580.0bp to feature; MODIFIER	silent_mutation	Average:61.555; most accessible tissue: Callus, score: 83.08	N	N	N	N
vg1225988493	G -> C	LOC_Os12g41920-LOC_Os12g41930	intergenic_region ; MODIFIER	silent_mutation	Average:61.555; most accessible tissue: Callus, score: 83.08	N	N	N	N
vg1225988493	G -> DEL	N	N	silent_mutation	Average:61.555; most accessible tissue: Callus, score: 83.08	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1225988493	NA	3.47E-36	mr1105	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	1.67E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	1.19E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	9.84E-24	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	2.01E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	7.60E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	9.98E-36	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	4.49E-13	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	1.18E-38	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	1.82E-31	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	6.52E-34	mr1723	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	6.79E-12	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	4.89E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225988493	NA	5.19E-19	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251