Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225407241:

Variant ID: vg1225407241 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 25407241
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

CTCAGTGGCGCCACCAGCCTGGATAAGCCGAAAGGGTGGGGGGAGAGAGGGGTTACGGTTAGGTAAACCCTAACCACCCTGCGGTTATTGCACAGTCGTC[G/A]
CCACCGTCACATCCACTGCCTTTCCACCACCGCTGCCGCCGTCGTTCCTCCTTCCTTCCTCCGTCGGCAGTTGGCAGGATAGATCTACGCCGATGACTCC

Reverse complement sequence

GGAGTCATCGGCGTAGATCTATCCTGCCAACTGCCGACGGAGGAAGGAAGGAGGAACGACGGCGGCAGCGGTGGTGGAAAGGCAGTGGATGTGACGGTGG[C/T]
GACGACTGTGCAATAACCGCAGGGTGGTTAGGGTTTACCTAACCGTAACCCCTCTCTCCCCCCACCCTTTCGGCTTATCCAGGCTGGTGGCGCCACTGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.60%	3.40%	0.76%	3.17%	NA
All Indica	2759	93.20%	5.70%	0.83%	0.25%	NA
All Japonica	1512	99.60%	0.20%	0.20%	0.00%	NA
Aus	269	49.80%	0.00%	3.72%	46.47%	NA
Indica I	595	76.50%	20.30%	3.19%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.10%	0.80%	0.00%	0.11%	NA
Indica Intermediate	786	95.00%	3.70%	0.51%	0.76%	NA
Temperate Japonica	767	99.60%	0.00%	0.39%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	85.40%	0.00%	0.00%	14.58%	NA
Intermediate	90	93.30%	2.20%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1225407241	G -> DEL	N	N	silent_mutation	Average:73.713; most accessible tissue: Zhenshan97 panicle, score: 87.451	N	N	N	N
vg1225407241	G -> A	LOC_Os12g41040.1	upstream_gene_variant ; 3742.0bp to feature; MODIFIER	silent_mutation	Average:73.713; most accessible tissue: Zhenshan97 panicle, score: 87.451	N	N	N	N
vg1225407241	G -> A	LOC_Os12g41050.1	upstream_gene_variant ; 579.0bp to feature; MODIFIER	silent_mutation	Average:73.713; most accessible tissue: Zhenshan97 panicle, score: 87.451	N	N	N	N
vg1225407241	G -> A	LOC_Os12g41040-LOC_Os12g41050	intergenic_region ; MODIFIER	silent_mutation	Average:73.713; most accessible tissue: Zhenshan97 panicle, score: 87.451	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1225407241	NA	8.36E-08	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1225407241	NA	2.57E-08	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241	NA	6.86E-08	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241	NA	5.24E-06	mr1326	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241	NA	5.68E-10	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241	NA	2.49E-08	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241	NA	9.72E-06	mr1624	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241	NA	9.13E-13	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241	NA	4.56E-11	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241	NA	2.98E-11	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1225407241	NA	3.57E-10	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251