Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224523683:

Variant ID: vg1224523683 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24523683
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTACTGCAAGATATGGTTAGTGATTGGAAGATAGGGTTAGTATGATTATTAGTTAAAATTATCGAGTTTAACTTTTTAAGAAGAGGCATCCTATAATTT[G/A]
GGATGGAGAAAGTATGACCCTACAACTTATAAAATTGGGTTAAACTAAGTCTTATGGTAGTATGGATCGATGGTTGGTTTCGCTAACGTGGTATCCTCAT

Reverse complement sequence

ATGAGGATACCACGTTAGCGAAACCAACCATCGATCCATACTACCATAAGACTTAGTTTAACCCAATTTTATAAGTTGTAGGGTCATACTTTCTCCATCC[C/T]
AAATTATAGGATGCCTCTTCTTAAAAAGTTAAACTCGATAATTTTAACTAATAATCATACTAACCCTATCTTCCAATCACTAACCATATCTTGCAGTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 0.70% 0.76% 15.89% NA
All Indica  2759 89.20% 0.00% 0.43% 10.40% NA
All Japonica  1512 85.10% 2.20% 1.06% 11.64% NA
Aus  269 5.60% 0.00% 2.60% 91.82% NA
Indica I  595 65.90% 0.00% 1.68% 32.44% NA
Indica II  465 98.70% 0.00% 0.22% 1.08% NA
Indica III  913 98.00% 0.00% 0.00% 1.97% NA
Indica Intermediate  786 90.80% 0.00% 0.13% 9.03% NA
Temperate Japonica  767 94.70% 3.40% 1.17% 0.78% NA
Tropical Japonica  504 81.70% 0.00% 0.20% 18.06% NA
Japonica Intermediate  241 61.80% 2.90% 2.49% 32.78% NA
VI/Aromatic  96 66.70% 0.00% 0.00% 33.33% NA
Intermediate  90 88.90% 0.00% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224523683 G -> DEL N N silent_mutation Average:93.243; most accessible tissue: Zhenshan97 young leaf, score: 96.456 N N N N
vg1224523683 G -> A LOC_Os12g39710.1 upstream_gene_variant ; 2981.0bp to feature; MODIFIER silent_mutation Average:93.243; most accessible tissue: Zhenshan97 young leaf, score: 96.456 N N N N
vg1224523683 G -> A LOC_Os12g39700.1 intron_variant ; MODIFIER silent_mutation Average:93.243; most accessible tissue: Zhenshan97 young leaf, score: 96.456 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1224523683 G A 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224523683 NA 2.53E-06 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224523683 NA 5.35E-06 mr1052 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224523683 3.40E-07 1.39E-06 mr1159 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251