| Variant ID: vg1224514466 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 24514466 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACTACTATTACAAAACTCCCGCACAAAGAGTACACAATGATCAACTGCAGTCCCCTTTTTCAAATCATATGGACGATCATTGTAAGCTTTTCCTGTTTTT[C/T]
ATCAGCTGGAAGAGGCAGCTAACATGTACTTTTTCCATTCCTCCCTACTGTTTTCCACCCTTCATCCGGCTCCTGCTCGATCGGTGGTGGTTGTTGTGAA
TTCACAACAACCACCACCGATCGAGCAGGAGCCGGATGAAGGGTGGAAAACAGTAGGGAGGAATGGAAAAAGTACATGTTAGCTGCCTCTTCCAGCTGAT[G/A]
AAAAACAGGAAAAGCTTACAATGATCGTCCATATGATTTGAAAAAGGGGACTGCAGTTGATCATTGTGTACTCTTTGTGCGGGAGTTTTGTAATAGTAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.30% | 0.60% | 1.18% | 61.91% | NA |
| All Indica | 2759 | 4.60% | 0.00% | 0.87% | 94.49% | NA |
| All Japonica | 1512 | 95.80% | 1.40% | 1.92% | 0.86% | NA |
| Aus | 269 | 2.60% | 0.00% | 0.74% | 96.65% | NA |
| Indica I | 595 | 3.70% | 0.00% | 2.52% | 93.78% | NA |
| Indica II | 465 | 8.00% | 0.00% | 1.08% | 90.97% | NA |
| Indica III | 913 | 2.60% | 0.00% | 0.22% | 97.15% | NA |
| Indica Intermediate | 786 | 5.60% | 0.10% | 0.25% | 94.02% | NA |
| Temperate Japonica | 767 | 93.20% | 2.30% | 3.26% | 1.17% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 96.70% | 1.20% | 1.24% | 0.83% | NA |
| VI/Aromatic | 96 | 81.20% | 6.20% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 61.10% | 0.00% | 1.11% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1224514466 | C -> DEL | N | N | silent_mutation | Average:28.481; most accessible tissue: Callus, score: 82.407 | N | N | N | N |
| vg1224514466 | C -> T | LOC_Os12g39700.1 | downstream_gene_variant ; 118.0bp to feature; MODIFIER | silent_mutation | Average:28.481; most accessible tissue: Callus, score: 82.407 | N | N | N | N |
| vg1224514466 | C -> T | LOC_Os12g39690-LOC_Os12g39700 | intergenic_region ; MODIFIER | silent_mutation | Average:28.481; most accessible tissue: Callus, score: 82.407 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1224514466 | 5.37E-06 | 5.37E-06 | mr1008 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224514466 | 3.22E-06 | 9.82E-08 | mr1150 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224514466 | NA | 1.23E-06 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1224514466 | 7.93E-07 | 7.93E-07 | mr1861 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |