Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224270680:

Variant ID: vg1224270680 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24270680
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.06, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGCTATAGCTAGCTTGTGTCTTCCTTAAGCTCTCCTAAACCTTTCCCGCTTGGTACCGGCCGGCCTCTTTCCATGGATGCGAGACTCCAGCTGAGACG[A/C]
AGCTTAAATAGACACAACATTACCTGGCTTCCCTCTTGGCCCCACAATTAATTGGCCCCTTTTTTTCAGTTCTTATATATAGCCCCGGCTGGATACCAAA

Reverse complement sequence

TTTGGTATCCAGCCGGGGCTATATATAAGAACTGAAAAAAAGGGGCCAATTAATTGTGGGGCCAAGAGGGAAGCCAGGTAATGTTGTGTCTATTTAAGCT[T/G]
CGTCTCAGCTGGAGTCTCGCATCCATGGAAAGAGGCCGGCCGGTACCAAGCGGGAAAGGTTTAGGAGAGCTTAAGGAAGACACAAGCTAGCTATAGCTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.40%	18.00%	1.74%	36.80%	NA
All Indica	2759	42.80%	2.60%	1.99%	52.63%	NA
All Japonica	1512	49.00%	49.60%	0.73%	0.66%	NA
Aus	269	3.30%	0.70%	5.20%	90.71%	NA
Indica I	595	28.70%	6.20%	3.70%	61.34%	NA
Indica II	465	45.20%	3.40%	1.72%	49.68%	NA
Indica III	913	58.30%	0.40%	0.99%	40.31%	NA
Indica Intermediate	786	34.00%	1.90%	2.04%	62.09%	NA
Temperate Japonica	767	20.60%	77.70%	0.52%	1.17%	NA
Tropical Japonica	504	85.70%	13.50%	0.79%	0.00%	NA
Japonica Intermediate	241	62.70%	35.70%	1.24%	0.41%	NA
VI/Aromatic	96	85.40%	4.20%	0.00%	10.42%	NA
Intermediate	90	45.60%	26.70%	2.22%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224270680	A -> C	LOC_Os12g39440.1	downstream_gene_variant ; 3188.0bp to feature; MODIFIER	silent_mutation	Average:40.076; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1224270680	A -> C	LOC_Os12g39440.2	downstream_gene_variant ; 3188.0bp to feature; MODIFIER	silent_mutation	Average:40.076; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1224270680	A -> C	LOC_Os12g39440.3	downstream_gene_variant ; 3188.0bp to feature; MODIFIER	silent_mutation	Average:40.076; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1224270680	A -> C	LOC_Os12g39440.5	downstream_gene_variant ; 3188.0bp to feature; MODIFIER	silent_mutation	Average:40.076; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1224270680	A -> C	LOC_Os12g39430.1	intron_variant ; MODIFIER	silent_mutation	Average:40.076; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg1224270680	A -> DEL	N	N	silent_mutation	Average:40.076; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224270680	4.32E-06	3.04E-36	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	1.48E-11	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	5.74E-13	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	7.81E-07	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	4.08E-11	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	9.53E-27	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	1.29E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	1.72E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	5.78E-10	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	1.15E-09	6.08E-45	mr1137_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	8.28E-14	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	4.59E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	7.17E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	7.22E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	2.41E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	7.99E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	6.96E-06	3.44E-29	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	2.52E-08	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	9.25E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	6.09E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	1.05E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224270680	NA	1.77E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251