Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224020476:

Variant ID: vg1224020476 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 24020476
Reference Allele: TAlternative Allele: G,TGG
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, G: 0.18, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTAACCTTGTACGCATAACGAACATAAACCAATGGCCTCATCGTTTGGCATATTCATATGCTTATCAGCCAAAATTTAAATTTTCAACGTTAAATTTA[T/G,TGG]
AGCTGATTTTAGGATTTTTTTATCGAAGATTATTTTTCAGCCTTTGCTTTTAGATCGCTAAGAACATATATATAAAAGTTTTATTCACAAATTGATTTTC

Reverse complement sequence

GAAAATCAATTTGTGAATAAAACTTTTATATATATGTTCTTAGCGATCTAAAAGCAAAGGCTGAAAAATAATCTTCGATAAAAAAATCCTAAAATCAGCT[A/C,CCA]
TAAATTTAACGTTGAAAATTTAAATTTTGGCTGATAAGCATATGAATATGCCAAACGATGAGGCCATTGGTTTATGTTCGTTATGCGTACAAGGTTAGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 41.90% 0.87% 0.61% TGG: 4.61%
All Indica  2759 86.40% 12.20% 0.29% 0.54% TGG: 0.58%
All Japonica  1512 1.30% 98.70% 0.00% 0.00% NA
Aus  269 10.40% 3.30% 10.41% 4.46% TGG: 71.38%
Indica I  595 72.10% 26.90% 0.50% 0.50% NA
Indica II  465 85.40% 14.60% 0.00% 0.00% NA
Indica III  913 97.40% 2.00% 0.11% 0.44% TGG: 0.11%
Indica Intermediate  786 85.10% 11.50% 0.51% 1.02% TGG: 1.91%
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 89.60% 3.12% 0.00% TGG: 5.21%
Intermediate  90 30.00% 60.00% 2.22% 2.22% TGG: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224020476 T -> DEL N N silent_mutation Average:69.313; most accessible tissue: Zhenshan97 panicle, score: 92.904 N N N N
vg1224020476 T -> G LOC_Os12g39040-LOC_Os12g39060 intergenic_region ; MODIFIER silent_mutation Average:69.313; most accessible tissue: Zhenshan97 panicle, score: 92.904 N N N N
vg1224020476 T -> TGG LOC_Os12g39040-LOC_Os12g39060 intergenic_region ; MODIFIER silent_mutation Average:69.313; most accessible tissue: Zhenshan97 panicle, score: 92.904 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1224020476 T G 0.01 0.0 0.01 -0.01 0.0 0.02
vg1224020476 T TGG -0.13 -0.09 -0.03 -0.08 -0.11 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224020476 NA 2.72E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 9.42E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 9.12E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 7.38E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 5.08E-32 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 9.75E-13 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 8.89E-06 mr1571 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 1.11E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 6.35E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 2.62E-09 mr1064_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 8.42E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 1.52E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 1.36E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 4.66E-17 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 8.06E-47 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 1.44E-14 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 1.38E-18 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 1.72E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 1.17E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224020476 NA 5.41E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251