Variant ID: vg1224016863 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 24016863 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 97. )
AGAATGTTTACTGTAGCATCACATAGGCTAATCATGAATTAATTAGGCTCAATAGATTCGTCTCACGAATTAGTCCAAGATTATGGATGGGTTTTATTAA[T/C]
AGTCTATGTTCAATATTTATAATTAGTGTCTAAACATCCACGATGTGATAGGGACTTAAAAGTTTTAGTCACATCTAAACAGGTCTAAGATCGTGCCTTG
CAAGGCACGATCTTAGACCTGTTTAGATGTGACTAAAACTTTTAAGTCCCTATCACATCGTGGATGTTTAGACACTAATTATAAATATTGAACATAGACT[A/G]
TTAATAAAACCCATCCATAATCTTGGACTAATTCGTGAGACGAATCTATTGAGCCTAATTAATTCATGATTAGCCTATGTGATGCTACAGTAAACATTCT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 84.70% | 15.10% | 0.17% | 0.00% | NA |
All Indica | 2759 | 84.10% | 15.60% | 0.29% | 0.00% | NA |
All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Aus | 269 | 10.00% | 90.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 79.70% | 20.20% | 0.17% | 0.00% | NA |
Indica II | 465 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
Indica III | 913 | 89.20% | 10.60% | 0.22% | 0.00% | NA |
Indica Intermediate | 786 | 74.70% | 24.70% | 0.64% | 0.00% | NA |
Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1224016863 | T -> C | LOC_Os12g39040.1 | downstream_gene_variant ; 2991.0bp to feature; MODIFIER | silent_mutation | Average:51.747; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
vg1224016863 | T -> C | LOC_Os12g39040-LOC_Os12g39060 | intergenic_region ; MODIFIER | silent_mutation | Average:51.747; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1224016863 | NA | 9.51E-09 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224016863 | NA | 3.68E-08 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224016863 | NA | 7.15E-11 | mr1126 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224016863 | 1.57E-06 | 1.57E-06 | mr1160 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224016863 | NA | 1.44E-07 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224016863 | NA | 3.98E-06 | mr1331 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224016863 | NA | 2.16E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224016863 | NA | 8.80E-09 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224016863 | NA | 7.03E-06 | mr1544 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1224016863 | NA | 1.15E-06 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/