Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224016863:

Variant ID: vg1224016863 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24016863
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


AGAATGTTTACTGTAGCATCACATAGGCTAATCATGAATTAATTAGGCTCAATAGATTCGTCTCACGAATTAGTCCAAGATTATGGATGGGTTTTATTAA[T/C]
AGTCTATGTTCAATATTTATAATTAGTGTCTAAACATCCACGATGTGATAGGGACTTAAAAGTTTTAGTCACATCTAAACAGGTCTAAGATCGTGCCTTG

Reverse complement sequence

CAAGGCACGATCTTAGACCTGTTTAGATGTGACTAAAACTTTTAAGTCCCTATCACATCGTGGATGTTTAGACACTAATTATAAATATTGAACATAGACT[A/G]
TTAATAAAACCCATCCATAATCTTGGACTAATTCGTGAGACGAATCTATTGAGCCTAATTAATTCATGATTAGCCTATGTGATGCTACAGTAAACATTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 15.10% 0.17% 0.00% NA
All Indica  2759 84.10% 15.60% 0.29% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 10.00% 90.00% 0.00% 0.00% NA
Indica I  595 79.70% 20.20% 0.17% 0.00% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 89.20% 10.60% 0.22% 0.00% NA
Indica Intermediate  786 74.70% 24.70% 0.64% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224016863 T -> C LOC_Os12g39040.1 downstream_gene_variant ; 2991.0bp to feature; MODIFIER silent_mutation Average:51.747; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1224016863 T -> C LOC_Os12g39040-LOC_Os12g39060 intergenic_region ; MODIFIER silent_mutation Average:51.747; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224016863 NA 9.51E-09 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 3.68E-08 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 7.15E-11 mr1126 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 1.57E-06 1.57E-06 mr1160 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 1.44E-07 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 3.98E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 2.16E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 8.80E-09 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 7.03E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 1.15E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 1.19E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 3.62E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 1.85E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 4.67E-11 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 2.89E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 6.48E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 1.87E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 7.94E-07 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224016863 NA 5.34E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251