Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223934169:

Variant ID: vg1223934169 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23934169
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, T: 0.12, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GTCCAAATGTTCTCGACACAATGACTCATCATATTTACAATCTTGGTGCTGGTAAGTACTTCCTAGATATAATGTTAGAACCACTCCTTAATTCATCTTT[G/T]
TTTTTAGGTTGTACTACACATTTAAGATGACTGACATAAACCAAATTTTATTAGGTAACGATCCGCAAGTTGCAAATAGGATCTTGAATCCGCAGTATTT

Reverse complement sequence

AAATACTGCGGATTCAAGATCCTATTTGCAACTTGCGGATCGTTACCTAATAAAATTTGGTTTATGTCAGTCATCTTAAATGTGTAGTACAACCTAAAAA[C/A]
AAAGATGAATTAAGGAGTGGTTCTAACATTATATCTAGGAAGTACTTACCAGCACCAAGATTGTAAATATGATGAGTCATTGTGTCGAGAACATTTGGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.70%	31.90%	0.08%	0.34%	NA
All Indica	2759	58.50%	40.80%	0.11%	0.58%	NA
All Japonica	1512	92.20%	7.70%	0.07%	0.00%	NA
Aus	269	11.90%	88.10%	0.00%	0.00%	NA
Indica I	595	76.80%	22.50%	0.17%	0.50%	NA
Indica II	465	91.60%	8.00%	0.00%	0.43%	NA
Indica III	913	31.00%	68.00%	0.11%	0.88%	NA
Indica Intermediate	786	56.90%	42.60%	0.13%	0.38%	NA
Temperate Japonica	767	96.60%	3.30%	0.13%	0.00%	NA
Tropical Japonica	504	94.60%	5.40%	0.00%	0.00%	NA
Japonica Intermediate	241	73.00%	27.00%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223934169	G -> DEL	N	N	silent_mutation	Average:62.793; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N
vg1223934169	G -> T	LOC_Os12g38930.1	downstream_gene_variant ; 1712.0bp to feature; MODIFIER	silent_mutation	Average:62.793; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N
vg1223934169	G -> T	LOC_Os12g38920.1	intron_variant ; MODIFIER	silent_mutation	Average:62.793; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N
vg1223934169	G -> T	LOC_Os12g38920.2	intron_variant ; MODIFIER	silent_mutation	Average:62.793; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223934169	NA	1.05E-17	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1223934169	NA	1.75E-10	mr1066	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169	NA	1.18E-06	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169	NA	1.54E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169	NA	4.27E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169	NA	4.49E-06	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169	NA	1.13E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169	NA	3.46E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169	NA	5.01E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169	NA	6.73E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223934169	NA	6.07E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251