Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223534586:

Variant ID: vg1223534586 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23534586
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

TATATCAGTTGTTCTAGGGTGGTTTTAGTGGTTTAATTTGTGGATAAGGAAGGTTAGAGAAGGAGTTTTGTTTGTTGTGGTTCGAATTGGCTGTTCTGCA[T/C]
GTTGGCAGATTTACAGTGTTTCGGTTTTTTGAAGTTTCGGAGAGCTAAATGATATTTTCTGCGAAAGTGTATAACTAGAAAGTTGTAGATAATATTTATA

Reverse complement sequence

TATAAATATTATCTACAACTTTCTAGTTATACACTTTCGCAGAAAATATCATTTAGCTCTCCGAAACTTCAAAAAACCGAAACACTGTAAATCTGCCAAC[A/G]
TGCAGAACAGCCAATTCGAACCACAACAAACAAAACTCCTTCTCTAACCTTCCTTATCCACAAATTAAACCACTAAAACCACCCTAGAACAACTGATATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.30%	19.70%	4.04%	1.04%	NA
All Indica	2759	95.10%	3.20%	1.78%	0.00%	NA
All Japonica	1512	46.30%	49.00%	1.46%	3.24%	NA
Aus	269	35.30%	25.30%	39.41%	0.00%	NA
Indica I	595	97.60%	1.00%	1.34%	0.00%	NA
Indica II	465	96.60%	3.00%	0.43%	0.00%	NA
Indica III	913	95.40%	3.50%	1.10%	0.00%	NA
Indica Intermediate	786	91.90%	4.50%	3.69%	0.00%	NA
Temperate Japonica	767	56.20%	38.70%	1.96%	3.13%	NA
Tropical Japonica	504	25.20%	69.60%	0.99%	4.17%	NA
Japonica Intermediate	241	58.90%	38.60%	0.83%	1.66%	NA
VI/Aromatic	96	93.80%	3.10%	3.12%	0.00%	NA
Intermediate	90	54.40%	33.30%	12.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223534586	T -> C	LOC_Os12g38370.1	upstream_gene_variant ; 4610.0bp to feature; MODIFIER	silent_mutation	Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1223534586	T -> C	LOC_Os12g38350.1	downstream_gene_variant ; 3573.0bp to feature; MODIFIER	silent_mutation	Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1223534586	T -> C	LOC_Os12g38360.1	downstream_gene_variant ; 1391.0bp to feature; MODIFIER	silent_mutation	Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1223534586	T -> C	LOC_Os12g38360-LOC_Os12g38370	intergenic_region ; MODIFIER	silent_mutation	Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1223534586	T -> DEL	N	N	silent_mutation	Average:19.153; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1223534586	NA	4.69E-13	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586	NA	1.07E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586	NA	2.91E-08	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586	NA	1.30E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586	NA	1.12E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586	NA	1.34E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586	6.10E-06	2.56E-20	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586	NA	3.09E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1223534586	NA	1.03E-09	mr1335_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251