Variant ID: vg1222877206 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 22877206 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )
TGGCAGCTCTATTTAGCCAAAACAAATAAAAGAATGATGGGACCCATTTGTCAGCCCAGTCCGTCTTCTTCTCCCCATCCTCTCTTTCGCTCGATCTCAG[C/T]
TACTGTCGCCGATGACCATCTCCACCAGACGTGCACCGAAGGCAAAGCCAAGACAAGCAGCGCTGAGATTTAGGGGTGACACGAGGCAGTGGAACTAACA
TGTTAGTTCCACTGCCTCGTGTCACCCCTAAATCTCAGCGCTGCTTGTCTTGGCTTTGCCTTCGGTGCACGTCTGGTGGAGATGGTCATCGGCGACAGTA[G/A]
CTGAGATCGAGCGAAAGAGAGGATGGGGAGAAGAAGACGGACTGGGCTGACAAATGGGTCCCATCATTCTTTTATTTGTTTTGGCTAAATAGAGCTGCCA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 81.40% | 18.50% | 0.11% | 0.00% | NA |
All Indica | 2759 | 69.00% | 30.80% | 0.18% | 0.00% | NA |
All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 73.50% | 26.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 51.60% | 48.10% | 0.33% | 0.00% | NA |
Indica Intermediate | 786 | 73.00% | 26.70% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1222877206 | C -> T | LOC_Os12g37290.1 | downstream_gene_variant ; 4993.0bp to feature; MODIFIER | silent_mutation | Average:63.582; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
vg1222877206 | C -> T | LOC_Os12g37280.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.582; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1222877206 | NA | 1.68E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1222877206 | 3.34E-06 | 1.44E-06 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1222877206 | 7.78E-06 | 3.05E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1222877206 | 3.48E-07 | 1.40E-07 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1222877206 | 2.85E-07 | 5.60E-08 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1222877206 | 2.93E-08 | 4.27E-08 | mr1389_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1222877206 | 7.25E-08 | 3.15E-09 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |