Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222433809:

Variant ID: vg1222433809 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 22433809
Reference Allele: AACC	Alternative Allele: GACC,A
Primary Allele: AACC	Secondary Allele: GACC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAACTCCTCCTATATCTGTAGGTTGTTTCCGTATAGGACATAGTATGTGGTAGGTCCTGCCGAGATTTAGTCAACTACTATTAGATATGTGGTATCCAT[AACC/GACC,A]
TGACAATATAATTGGTTGAAGGTTCACTTAGATGGTGCTGTCGAGTTGATGATCACAGCAGCCAAACACTAAGCTCTTTCGCCTTATAAGATCGTTAACA

Reverse complement sequence

TGTTAACGATCTTATAAGGCGAAAGAGCTTAGTGTTTGGCTGCTGTGATCATCAACTCGACAGCACCATCTAAGTGAACCTTCAACCAATTATATTGTCA[GGTT/GGTC,T]
ATGGATACCACATATCTAATAGTAGTTGACTAAATCTCGGCAGGACCTACCACATACTATGTCCTATACGGAAACAACCTACAGATATAGGAGGAGTTCC

Allele Frequencies:

Populations	Population Size	Frequency of AACC(primary allele)	Frequency of GACC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.40%	4.50%	1.71%	39.29%	A: 0.02%
All Indica	2759	37.40%	7.10%	2.54%	52.95%	NA
All Japonica	1512	84.30%	0.20%	0.53%	15.01%	NA
Aus	269	37.90%	3.30%	0.74%	57.99%	NA
Indica I	595	48.60%	11.90%	2.02%	37.48%	NA
Indica II	465	50.10%	2.40%	3.01%	44.52%	NA
Indica III	913	26.00%	6.50%	1.64%	65.94%	NA
Indica Intermediate	786	34.60%	7.10%	3.69%	54.58%	NA
Temperate Japonica	767	87.60%	0.00%	0.52%	11.86%	NA
Tropical Japonica	504	77.40%	0.00%	0.40%	22.22%	NA
Japonica Intermediate	241	88.00%	1.20%	0.83%	9.96%	NA
VI/Aromatic	96	93.80%	2.10%	0.00%	3.12%	A: 1.04%
Intermediate	90	83.30%	4.40%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222433809	AACC -> DEL	N	N	silent_mutation	Average:25.639; most accessible tissue: Callus, score: 62.606	N	N	N	N
vg1222433809	AACC -> A	LOC_Os12g36630.1	upstream_gene_variant ; 4712.0bp to feature; MODIFIER	silent_mutation	Average:25.639; most accessible tissue: Callus, score: 62.606	N	N	N	N
vg1222433809	AACC -> A	LOC_Os12g36640.1	upstream_gene_variant ; 2010.0bp to feature; MODIFIER	silent_mutation	Average:25.639; most accessible tissue: Callus, score: 62.606	N	N	N	N
vg1222433809	AACC -> A	LOC_Os12g36640.2	upstream_gene_variant ; 2015.0bp to feature; MODIFIER	silent_mutation	Average:25.639; most accessible tissue: Callus, score: 62.606	N	N	N	N
vg1222433809	AACC -> A	LOC_Os12g36640-LOC_Os12g36660	intergenic_region ; MODIFIER	silent_mutation	Average:25.639; most accessible tissue: Callus, score: 62.606	N	N	N	N
vg1222433809	AACC -> GACC	LOC_Os12g36630.1	upstream_gene_variant ; 4711.0bp to feature; MODIFIER	silent_mutation	Average:25.639; most accessible tissue: Callus, score: 62.606	N	N	N	N
vg1222433809	AACC -> GACC	LOC_Os12g36640.1	upstream_gene_variant ; 2009.0bp to feature; MODIFIER	silent_mutation	Average:25.639; most accessible tissue: Callus, score: 62.606	N	N	N	N
vg1222433809	AACC -> GACC	LOC_Os12g36640.2	upstream_gene_variant ; 2014.0bp to feature; MODIFIER	silent_mutation	Average:25.639; most accessible tissue: Callus, score: 62.606	N	N	N	N
vg1222433809	AACC -> GACC	LOC_Os12g36640-LOC_Os12g36660	intergenic_region ; MODIFIER	silent_mutation	Average:25.639; most accessible tissue: Callus, score: 62.606	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222433809	1.47E-06	7.55E-08	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433809	3.77E-07	3.77E-07	mr1738	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222433809	NA	5.58E-06	mr1965	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251