Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222349292:

Variant ID: vg1222349292 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22349292
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

ACGGGCATCTTTTCTAGTACTCTATAAAATTATTGCAATACACTGAATAATAGTACGATAAAATTTCAATAGCCCCCGTGGTGTGGGTTGGTTGAAGGAA[G/A]
GAAAAGGATTACGGTTAAGGGGAACTAGGTTTTTAAGCTTTTATATGTCAATTTTAAATGGGCTTGTTGGGTCTATATTATTAAAATGGGCTAATTTTAT

Reverse complement sequence

ATAAAATTAGCCCATTTTAATAATATAGACCCAACAAGCCCATTTAAAATTGACATATAAAAGCTTAAAAACCTAGTTCCCCTTAACCGTAATCCTTTTC[C/T]
TTCCTTCAACCAACCCACACCACGGGGGCTATTGAAATTTTATCGTACTATTATTCAGTGTATTGCAATAATTTTATAGAGTACTAGAAAAGATGCCCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.40%	7.40%	3.05%	49.09%	NA
All Indica	2759	19.30%	11.80%	0.72%	68.18%	NA
All Japonica	1512	75.10%	0.30%	7.21%	17.46%	NA
Aus	269	67.30%	4.10%	0.74%	27.88%	NA
Indica I	595	3.20%	11.90%	0.17%	84.71%	NA
Indica II	465	29.20%	3.90%	0.65%	66.24%	NA
Indica III	913	23.80%	13.90%	0.77%	61.56%	NA
Indica Intermediate	786	20.50%	13.90%	1.15%	64.50%	NA
Temperate Japonica	767	87.90%	0.00%	5.61%	6.52%	NA
Tropical Japonica	504	65.90%	0.20%	7.34%	26.59%	NA
Japonica Intermediate	241	53.50%	1.20%	12.03%	33.20%	NA
VI/Aromatic	96	11.50%	2.10%	10.42%	76.04%	NA
Intermediate	90	56.70%	10.00%	3.33%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222349292	G -> DEL	N	N	silent_mutation	Average:32.628; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg1222349292	G -> A	LOC_Os12g36510.1	downstream_gene_variant ; 779.0bp to feature; MODIFIER	silent_mutation	Average:32.628; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg1222349292	G -> A	LOC_Os12g36500-LOC_Os12g36510	intergenic_region ; MODIFIER	silent_mutation	Average:32.628; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222349292	NA	7.35E-07	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349292	NA	2.48E-06	mr1176	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349292	NA	3.76E-06	mr1471	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349292	NA	9.03E-07	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349292	NA	3.79E-06	mr1660	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349292	3.21E-07	3.49E-07	mr1738	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222349292	3.20E-06	3.20E-06	mr1738	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251