Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222202905:

Variant ID: vg1222202905 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22202905
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTGAAGGCAGGCAGATGAGGCTAGTAGCTAGCTCTAGCCGATGGTGGGGGTGCCGGCGACGGTGTCGACGAAGATGCGGACGCGGTTGGGGCGGAAGTC[C/G]
ATGGTCACCGGCGTCCCCACCGGAACCACGACGATGTCGGCGTCGGGCATGTCCTTGAGGATCACCTTCTTCGCCTCCTCCGCCCGCAGCCCCACCACCT

Reverse complement sequence

AGGTGGTGGGGCTGCGGGCGGAGGAGGCGAAGAAGGTGATCCTCAAGGACATGCCCGACGCCGACATCGTCGTGGTTCCGGTGGGGACGCCGGTGACCAT[G/C]
GACTTCCGCCCCAACCGCGTCCGCATCTTCGTCGACACCGTCGCCGGCACCCCCACCATCGGCTAGAGCTAGCTACTAGCCTCATCTGCCTGCCTTCAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.90%	1.50%	0.40%	14.24%	NA
All Indica	2759	96.30%	0.00%	0.11%	3.55%	NA
All Japonica	1512	64.30%	4.50%	0.86%	30.36%	NA
Aus	269	91.80%	0.00%	0.00%	8.18%	NA
Indica I	595	91.80%	0.00%	0.17%	8.07%	NA
Indica II	465	98.50%	0.00%	0.22%	1.29%	NA
Indica III	913	97.20%	0.00%	0.00%	2.85%	NA
Indica Intermediate	786	97.60%	0.00%	0.13%	2.29%	NA
Temperate Japonica	767	85.30%	7.40%	0.52%	6.78%	NA
Tropical Japonica	504	41.50%	0.80%	1.59%	56.15%	NA
Japonica Intermediate	241	45.20%	2.90%	0.41%	51.45%	NA
VI/Aromatic	96	21.90%	1.00%	3.12%	73.96%	NA
Intermediate	90	73.30%	1.10%	0.00%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222202905	C -> DEL	LOC_Os12g36240.1	N	frameshift_variant	Average:85.313; most accessible tissue: Zhenshan97 root, score: 96.46	N	N	N	N
vg1222202905	C -> G	LOC_Os12g36240.1	missense_variant ; p.Met64Ile; MODERATE	nonsynonymous_codon ; M64L	Average:85.313; most accessible tissue: Zhenshan97 root, score: 96.46	benign	-0.417	TOLERATED	0.48

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1222202905	C	G	0.02	-0.01	-0.02	-0.02	-0.01	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222202905	NA	1.69E-11	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1222202905	8.29E-07	4.85E-06	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222202905	5.46E-06	NA	mr1332	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222202905	5.55E-06	NA	mr1614	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251