Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1222170941:

Variant ID: vg1222170941 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 22170941
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTGGGCTAGGATAGGATGTATAATAGTTATTCTATACTCACATCAAATTGGATACGGACGATATATAACAACTCAAAAACGGATGACGTATCAAAATTT[C/T]
GACAAAAAACATCTTTGATTTTTATAATAGTAGATATATGTTTGTTTTGTGTTAAAAATGCTACTATGTTTTTCTATAAACTTGGACAAACTTTAAAAAG

Reverse complement sequence

CTTTTTAAAGTTTGTCCAAGTTTATAGAAAAACATAGTAGCATTTTTAACACAAAACAAACATATATCTACTATTATAAAAATCAAAGATGTTTTTTGTC[G/A]
AAATTTTGATACGTCATCCGTTTTTGAGTTGTTATATATCGTCCGTATCCAATTTGATGTGAGTATAGAATAACTATTATACATCCTATCCTAGCCCAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.10%	2.20%	6.58%	2.20%	NA
All Indica	2759	83.60%	3.70%	9.06%	3.62%	NA
All Japonica	1512	95.80%	0.00%	3.90%	0.26%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	83.90%	7.10%	9.08%	0.00%	NA
Indica II	465	71.80%	0.60%	12.47%	15.05%	NA
Indica III	913	93.40%	2.10%	3.72%	0.77%	NA
Indica Intermediate	786	79.00%	4.80%	13.23%	2.93%	NA
Temperate Japonica	767	93.40%	0.00%	6.13%	0.52%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	95.40%	0.00%	4.56%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	0.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1222170941	C -> DEL	N	N	silent_mutation	Average:43.615; most accessible tissue: Callus, score: 76.834	N	N	N	N
vg1222170941	C -> T	LOC_Os12g36170.1	upstream_gene_variant ; 1121.0bp to feature; MODIFIER	silent_mutation	Average:43.615; most accessible tissue: Callus, score: 76.834	N	N	N	N
vg1222170941	C -> T	LOC_Os12g36180.1	downstream_gene_variant ; 2341.0bp to feature; MODIFIER	silent_mutation	Average:43.615; most accessible tissue: Callus, score: 76.834	N	N	N	N
vg1222170941	C -> T	LOC_Os12g36170-LOC_Os12g36180	intergenic_region ; MODIFIER	silent_mutation	Average:43.615; most accessible tissue: Callus, score: 76.834	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1222170941	NA	8.73E-07	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222170941	NA	2.21E-06	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222170941	NA	2.55E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222170941	NA	9.25E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222170941	NA	5.70E-07	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1222170941	3.98E-07	1.03E-11	mr1676_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251