Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221931538:

Variant ID: vg1221931538 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21931538
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTTATATAGAAAAATAACCAAAATAAAAGCTATAGATCTTGATGAGTTATACAACTTTGTTGTTGATGATTTTTTTAGTTGAAATCATTTAGTATTTG[A/G]
AAATGTTTTTTCTGAAGTTGTCATATTTTTAAATTCAAATTCAAACCGTTCAAAAAAAAGTTTATATTGAAAAATGACCAAAATAAAAGTTTTAACACTT

Reverse complement sequence

AAGTGTTAAAACTTTTATTTTGGTCATTTTTCAATATAAACTTTTTTTTGAACGGTTTGAATTTGAATTTAAAAATATGACAACTTCAGAAAAAACATTT[T/C]
CAAATACTAAATGATTTCAACTAAAAAAATCATCAACAACAAAGTTGTATAACTCATCAAGATCTATAGCTTTTATTTTGGTTATTTTTCTATATAACTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.70%	28.40%	4.04%	12.82%	NA
All Indica	2759	31.20%	47.80%	6.56%	14.39%	NA
All Japonica	1512	90.90%	0.30%	0.26%	8.60%	NA
Aus	269	75.50%	2.20%	1.49%	20.82%	NA
Indica I	595	9.90%	76.50%	9.08%	4.54%	NA
Indica II	465	60.90%	15.30%	8.39%	15.48%	NA
Indica III	913	29.00%	45.00%	4.93%	21.03%	NA
Indica Intermediate	786	32.30%	48.70%	5.47%	13.49%	NA
Temperate Japonica	767	96.60%	0.00%	0.26%	3.13%	NA
Tropical Japonica	504	79.00%	0.60%	0.40%	20.04%	NA
Japonica Intermediate	241	97.50%	0.40%	0.00%	2.07%	NA
VI/Aromatic	96	82.30%	1.00%	0.00%	16.67%	NA
Intermediate	90	76.70%	13.30%	2.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221931538	A -> DEL	N	N	silent_mutation	Average:13.722; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1221931538	A -> G	LOC_Os12g35920-LOC_Os12g35930	intergenic_region ; MODIFIER	silent_mutation	Average:13.722; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221931538	NA	2.81E-09	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538	NA	1.92E-07	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538	NA	2.60E-19	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538	NA	9.68E-07	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538	NA	1.14E-07	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538	NA	5.77E-11	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538	NA	1.53E-44	mr1598_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538	NA	1.32E-13	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221931538	NA	4.32E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251