Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221855135:

Variant ID: vg1221855135 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21855135
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.54, T: 0.47, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GTGAGCGTAGTTTAACTGGTTAGGTTTCTTGTGGTGGAACCAACGCACCTGGATTCAAATTCTAGATTTAACATGAGTGCTCGCATTTAATTATTCTTTC[T/C]
GTGGCAGTGTGCACACGTTGTAAGCGTCTGCATTTGTACACTGTGTTTCTAACAAAAAAAAAAGGGTAAGAAAGAGCACATGACATTATGTCACACCATA

Reverse complement sequence

TATGGTGTGACATAATGTCATGTGCTCTTTCTTACCCTTTTTTTTTTGTTAGAAACACAGTGTACAAATGCAGACGCTTACAACGTGTGCACACTGCCAC[A/G]
GAAAGAATAATTAAATGCGAGCACTCATGTTAAATCTAGAATTTGAATCCAGGTGCGTTGGTTCCACCACAAGAAACCTAACCAGTTAAACTACGCTCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.50%	37.40%	0.13%	0.00%	NA
All Indica	2759	93.30%	6.60%	0.14%	0.00%	NA
All Japonica	1512	5.50%	94.40%	0.07%	0.00%	NA
Aus	269	85.10%	14.50%	0.37%	0.00%	NA
Indica I	595	85.40%	14.50%	0.17%	0.00%	NA
Indica II	465	94.80%	4.70%	0.43%	0.00%	NA
Indica III	913	97.20%	2.80%	0.00%	0.00%	NA
Indica Intermediate	786	93.80%	6.10%	0.13%	0.00%	NA
Temperate Japonica	767	4.20%	95.80%	0.00%	0.00%	NA
Tropical Japonica	504	8.70%	91.10%	0.20%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	39.60%	60.40%	0.00%	0.00%	NA
Intermediate	90	33.30%	66.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221855135	T -> C	LOC_Os12g35880.1	upstream_gene_variant ; 4113.0bp to feature; MODIFIER	silent_mutation	Average:45.347; most accessible tissue: Minghui63 panicle, score: 90.833	N	N	N	N
vg1221855135	T -> C	LOC_Os12g35860.1	downstream_gene_variant ; 2538.0bp to feature; MODIFIER	silent_mutation	Average:45.347; most accessible tissue: Minghui63 panicle, score: 90.833	N	N	N	N
vg1221855135	T -> C	LOC_Os12g35870.1	downstream_gene_variant ; 2008.0bp to feature; MODIFIER	silent_mutation	Average:45.347; most accessible tissue: Minghui63 panicle, score: 90.833	N	N	N	N
vg1221855135	T -> C	LOC_Os12g35860-LOC_Os12g35870	intergenic_region ; MODIFIER	silent_mutation	Average:45.347; most accessible tissue: Minghui63 panicle, score: 90.833	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221855135	NA	1.32E-46	mr1016	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	5.69E-37	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	1.83E-06	5.37E-77	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	1.44E-57	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	1.80E-28	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	7.84E-60	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	5.54E-35	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	2.03E-72	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	9.19E-62	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	3.82E-16	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	2.26E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	8.73E-06	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	5.76E-54	mr1390	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	4.27E-69	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	2.19E-54	mr1490	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	4.41E-66	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	1.61E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	7.41E-06	NA	mr1645	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	7.50E-74	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	1.21E-69	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	2.02E-71	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	8.09E-47	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	7.73E-83	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	4.18E-62	mr1390_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	1.09E-76	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	6.52E-64	mr1490_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	5.12E-06	2.44E-76	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221855135	NA	1.51E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251