| Variant ID: vg1221792676 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21792676 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 236. )
CCCTTCTTGCCTTCTCTTTGTTCACGATGTCACCAACTAGAAAACCTATTGGTTGTCTGCCTTTTGGTAGATGCCGGAGATGTAAATCATTTTCTATTTT[T/C]
CATTAGATAAGTATTAAGGAACTGTTCCATTGATGTGATTGACGCAGCTTGCAATTGGAGAGTTAGTTTTCCTGCATGATCTTACCTACAGTGTGCAGTC
GACTGCACACTGTAGGTAAGATCATGCAGGAAAACTAACTCTCCAATTGCAAGCTGCGTCAATCACATCAATGGAACAGTTCCTTAATACTTATCTAATG[A/G]
AAAATAGAAAATGATTTACATCTCCGGCATCTACCAAAAGGCAGACAACCAATAGGTTTTCTAGTTGGTGACATCGTGAACAAAGAGAAGGCAAGAAGGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.90% | 26.30% | 1.29% | 28.52% | NA |
| All Indica | 2759 | 58.10% | 2.70% | 1.85% | 37.37% | NA |
| All Japonica | 1512 | 26.50% | 68.70% | 0.13% | 4.70% | NA |
| Aus | 269 | 1.90% | 11.20% | 2.60% | 84.39% | NA |
| Indica I | 595 | 70.10% | 2.00% | 3.03% | 24.87% | NA |
| Indica II | 465 | 77.00% | 4.50% | 0.86% | 17.63% | NA |
| Indica III | 913 | 41.30% | 1.60% | 1.64% | 55.42% | NA |
| Indica Intermediate | 786 | 57.30% | 3.40% | 1.78% | 37.53% | NA |
| Temperate Japonica | 767 | 14.60% | 82.10% | 0.13% | 3.13% | NA |
| Tropical Japonica | 504 | 31.20% | 60.30% | 0.20% | 8.33% | NA |
| Japonica Intermediate | 241 | 54.80% | 43.20% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 37.50% | 55.20% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 33.30% | 52.20% | 1.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221792676 | T -> C | LOC_Os12g35770-LOC_Os12g35790 | intergenic_region ; MODIFIER | silent_mutation | Average:32.125; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| vg1221792676 | T -> DEL | N | N | silent_mutation | Average:32.125; most accessible tissue: Zhenshan97 young leaf, score: 67.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221792676 | 4.13E-06 | 4.14E-06 | mr1265 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221792676 | NA | 6.76E-07 | mr1332 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221792676 | 4.95E-06 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221792676 | NA | 7.55E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221792676 | NA | 1.14E-08 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221792676 | NA | 1.94E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221792676 | 3.82E-06 | NA | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221792676 | NA | 1.69E-07 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221792676 | NA | 2.39E-07 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221792676 | NA | 1.20E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |