Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221775967:

Variant ID: vg1221775967 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21775967
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

CTCCCTCTGCTCATCCAAATCGGCAAGGAGCCGAGCTCCTTTCCCCTCCCCTTTTTGCTTTTTCCCTCTCAGCCCGGCCGCCCGTGACCACCTCCACTGC[T/C]
GCCGCTTGGCCGCTAGCTCTGAGCACGACCGCCAGCCGAGCTCCCTTGACCACCTAAGTCGGTTTCCTCCCCCAAAACTGACTTCCCGTGCCTATAAAAC

Reverse complement sequence

GTTTTATAGGCACGGGAAGTCAGTTTTGGGGGAGGAAACCGACTTAGGTGGTCAAGGGAGCTCGGCTGGCGGTCGTGCTCAGAGCTAGCGGCCAAGCGGC[A/G]
GCAGTGGAGGTGGTCACGGGCGGCCGGGCTGAGAGGGAAAAAGCAAAAAGGGGAGGGGAAAGGAGCTCGGCTCCTTGCCGATTTGGATGAGCAGAGGGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.40%	24.10%	1.27%	0.21%	NA
All Indica	2759	95.10%	2.90%	1.67%	0.36%	NA
All Japonica	1512	38.60%	61.30%	0.07%	0.00%	NA
Aus	269	88.50%	11.50%	0.00%	0.00%	NA
Indica I	595	96.00%	1.30%	2.69%	0.00%	NA
Indica II	465	90.80%	4.90%	2.80%	1.51%	NA
Indica III	913	97.30%	2.40%	0.33%	0.00%	NA
Indica Intermediate	786	94.40%	3.40%	1.78%	0.38%	NA
Temperate Japonica	767	28.40%	71.60%	0.00%	0.00%	NA
Tropical Japonica	504	39.90%	59.90%	0.20%	0.00%	NA
Japonica Intermediate	241	68.50%	31.50%	0.00%	0.00%	NA
VI/Aromatic	96	33.30%	57.30%	9.38%	0.00%	NA
Intermediate	90	43.30%	52.20%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221775967	T -> C	LOC_Os12g35770.1	upstream_gene_variant ; 4332.0bp to feature; MODIFIER	silent_mutation	Average:64.163; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg1221775967	T -> C	LOC_Os12g35760.1	downstream_gene_variant ; 391.0bp to feature; MODIFIER	silent_mutation	Average:64.163; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg1221775967	T -> C	LOC_Os12g35750-LOC_Os12g35760	intergenic_region ; MODIFIER	silent_mutation	Average:64.163; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg1221775967	T -> DEL	N	N	silent_mutation	Average:64.163; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221775967	NA	8.50E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967	NA	3.32E-10	mr1050_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967	NA	3.33E-07	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967	NA	1.34E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967	NA	8.84E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967	NA	7.86E-11	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967	NA	6.38E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967	NA	2.77E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967	NA	7.14E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967	6.17E-06	NA	mr1907_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967	1.47E-06	NA	mr1934_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221775967	NA	4.25E-10	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251