Variant ID: vg1221714133 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 21714133 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTATTTTTGGCGGGAATCGAGTTGGAGAAGATGCATGGGACCCACGTTTTGGACATGGTTGAGAGAAATGCAGTTTTCTGTTTAGGTTTATTGATATTTC[G/A]
GTTTTTGCTAAAAAAAAACTGGCGATGGATTTTTGTTGGAGAAACTTTCGATTTTCTGGCCGTCAAGATGCGCTTTTTGTTTAGTTACATGCAATGGAAC
GTTCCATTGCATGTAACTAAACAAAAAGCGCATCTTGACGGCCAGAAAATCGAAAGTTTCTCCAACAAAAATCCATCGCCAGTTTTTTTTTAGCAAAAAC[C/T]
GAAATATCAATAAACCTAAACAGAAAACTGCATTTCTCTCAACCATGTCCAAAACGTGGGTCCCATGCATCTTCTCCAACTCGATTCCCGCCAAAAATAG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.10% | 5.70% | 0.21% | 0.00% | NA |
All Indica | 2759 | 99.70% | 0.10% | 0.14% | 0.00% | NA |
All Japonica | 1512 | 82.50% | 17.10% | 0.40% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.60% | 0.10% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 78.60% | 21.00% | 0.39% | 0.00% | NA |
Tropical Japonica | 504 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 63.90% | 34.90% | 1.24% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1221714133 | G -> A | LOC_Os12g35710.1 | upstream_gene_variant ; 274.0bp to feature; MODIFIER | silent_mutation | Average:47.38; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
vg1221714133 | G -> A | LOC_Os12g35710-LOC_Os12g35720 | intergenic_region ; MODIFIER | silent_mutation | Average:47.38; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1221714133 | 5.44E-06 | 1.66E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1221714133 | 5.70E-06 | NA | mr1092_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1221714133 | NA | 2.26E-06 | mr1781_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1221714133 | 3.77E-06 | NA | mr1980_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |