Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221673234:

Variant ID: vg1221673234 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21673234
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGGTCAAACATGTTTAAAAAAGTCAACGGCGTCAAACATTTAGGGAAGGAGGTAGTATTATAGTACTCCCTCTGTTTCAAAATATTTGACACCGTTGAC[G/A]
TTGACTTTTTAGTACGTGTTTGACTATTCGTCTTATTAAAAAAATTTAAGTAATTATTTATTCTTTTTATATCATTTGATTCATTGTTAAATATACACTG

Reverse complement sequence

CAGTGTATATTTAACAATGAATCAAATGATATAAAAAGAATAAATAATTACTTAAATTTTTTTAATAAGACGAATAGTCAAACACGTACTAAAAAGTCAA[C/T]
GTCAACGGTGTCAAATATTTTGAAACAGAGGGAGTACTATAATACTACCTCCTTCCCTAAATGTTTGACGCCGTTGACTTTTTTAAACATGTTTGACCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	5.50%	0.17%	3.13%	NA
All Indica	2759	94.30%	0.10%	0.25%	5.33%	NA
All Japonica	1512	85.10%	14.80%	0.07%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	75.70%	0.00%	1.08%	23.23%	NA
Indica III	913	99.00%	0.30%	0.00%	0.66%	NA
Indica Intermediate	786	95.50%	0.10%	0.25%	4.07%	NA
Temperate Japonica	767	82.40%	17.30%	0.13%	0.13%	NA
Tropical Japonica	504	97.20%	2.80%	0.00%	0.00%	NA
Japonica Intermediate	241	68.00%	32.00%	0.00%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221673234	G -> DEL	N	N	silent_mutation	Average:35.19; most accessible tissue: Minghui63 young leaf, score: 64.378	N	N	N	N
vg1221673234	G -> A	LOC_Os12g35640.1	upstream_gene_variant ; 3855.0bp to feature; MODIFIER	silent_mutation	Average:35.19; most accessible tissue: Minghui63 young leaf, score: 64.378	N	N	N	N
vg1221673234	G -> A	LOC_Os12g35650.1	downstream_gene_variant ; 581.0bp to feature; MODIFIER	silent_mutation	Average:35.19; most accessible tissue: Minghui63 young leaf, score: 64.378	N	N	N	N
vg1221673234	G -> A	LOC_Os12g35640-LOC_Os12g35650	intergenic_region ; MODIFIER	silent_mutation	Average:35.19; most accessible tissue: Minghui63 young leaf, score: 64.378	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221673234	3.61E-07	6.79E-10	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234	NA	2.97E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234	1.92E-08	1.07E-14	mr1057_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234	NA	5.21E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234	NA	2.51E-07	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234	NA	9.85E-07	mr1736_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234	NA	3.69E-07	mr1781_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221673234	NA	3.10E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251