| Variant ID: vg1221520525 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 21520525 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGTGCACGGCGGCGGCTCACGGAAACGAAAGGCCAAGATCGATCCATCCAAAACGGACGGCCAAGATCCATCGGTCCATGACCGGGCCACGGGGAACGAC[G/A]
ACGATGACGTCAGCGGTGACGTCATCACCGGCGACGACTCGGGCACGCATGCCCGCCGGCGAACGACGGCGCGACAACGCGAACGGAGAGCACCAAAACG
CGTTTTGGTGCTCTCCGTTCGCGTTGTCGCGCCGTCGTTCGCCGGCGGGCATGCGTGCCCGAGTCGTCGCCGGTGATGACGTCACCGCTGACGTCATCGT[C/T]
GTCGTTCCCCGTGGCCCGGTCATGGACCGATGGATCTTGGCCGTCCGTTTTGGATGGATCGATCTTGGCCTTTCGTTTCCGTGAGCCGCCGCCGTGCACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.50% | 5.70% | 3.68% | 11.17% | NA |
| All Indica | 2759 | 72.70% | 9.50% | 4.89% | 12.90% | NA |
| All Japonica | 1512 | 99.40% | 0.10% | 0.07% | 0.40% | NA |
| Aus | 269 | 38.30% | 0.40% | 13.38% | 47.96% | NA |
| Indica I | 595 | 72.60% | 15.30% | 1.51% | 10.59% | NA |
| Indica II | 465 | 88.80% | 3.40% | 0.65% | 7.10% | NA |
| Indica III | 913 | 62.30% | 9.30% | 9.09% | 19.28% | NA |
| Indica Intermediate | 786 | 75.40% | 8.80% | 5.09% | 10.69% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 68.80% | 0.00% | 0.00% | 31.25% | NA |
| Intermediate | 90 | 84.40% | 5.60% | 2.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1221520525 | G -> DEL | N | N | silent_mutation | Average:65.121; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg1221520525 | G -> A | LOC_Os12g35390.1 | upstream_gene_variant ; 30.0bp to feature; MODIFIER | silent_mutation | Average:65.121; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg1221520525 | G -> A | LOC_Os12g35380.1 | downstream_gene_variant ; 4869.0bp to feature; MODIFIER | silent_mutation | Average:65.121; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg1221520525 | G -> A | LOC_Os12g35390-LOC_Os12g35395 | intergenic_region ; MODIFIER | silent_mutation | Average:65.121; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1221520525 | NA | 3.06E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221520525 | NA | 5.96E-07 | mr1057 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221520525 | NA | 7.19E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221520525 | NA | 2.32E-06 | mr1208 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221520525 | NA | 1.79E-06 | mr1530 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221520525 | NA | 3.75E-06 | mr1590 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221520525 | 4.73E-06 | 4.73E-06 | mr1656 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1221520525 | NA | 6.42E-07 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |