Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1221519059:

Variant ID: vg1221519059 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 21519059
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCAAGGTGAGTATATGACATACTCAGCAAGCCACGCAGCAAATATGCAAGTGCACAGGATAATAAAGGATGGCATAGTAGGGTTTCATTTGCATAAACA[G/A]
CATTTAATAAACATTTCAGAATTTAATAAAATAGTTAAGTAATAATTAAACAATATTAATCCAACGCTATACAACATACCCTGTTGCATAGGCCCAACCA

Reverse complement sequence

TGGTTGGGCCTATGCAACAGGGTATGTTGTATAGCGTTGGATTAATATTGTTTAATTATTACTTAACTATTTTATTAAATTCTGAAATGTTTATTAAATG[C/T]
TGTTTATGCAAATGAAACCCTACTATGCCATCCTTTATTATCCTGTGCACTTGCATATTTGCTGCGTGGCTTGCTGAGTATGTCATATACTCACCTTGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	5.50%	5.65%	2.18%	NA
All Indica	2759	80.90%	9.10%	7.18%	2.79%	NA
All Japonica	1512	99.50%	0.10%	0.26%	0.13%	NA
Aus	269	77.70%	0.40%	13.01%	8.92%	NA
Indica I	595	75.30%	15.30%	8.91%	0.50%	NA
Indica II	465	91.20%	3.40%	5.16%	0.22%	NA
Indica III	913	78.40%	8.50%	6.02%	7.01%	NA
Indica Intermediate	786	81.90%	8.50%	8.40%	1.15%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	0.00%	0.83%	0.83%	NA
VI/Aromatic	96	72.90%	1.00%	26.04%	0.00%	NA
Intermediate	90	88.90%	5.60%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1221519059	G -> DEL	N	N	silent_mutation	Average:49.462; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1221519059	G -> A	LOC_Os12g35380.1	downstream_gene_variant ; 3403.0bp to feature; MODIFIER	silent_mutation	Average:49.462; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1221519059	G -> A	LOC_Os12g35390.1	downstream_gene_variant ; 977.0bp to feature; MODIFIER	silent_mutation	Average:49.462; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1221519059	G -> A	LOC_Os12g35380-LOC_Os12g35390	intergenic_region ; MODIFIER	silent_mutation	Average:49.462; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1221519059	NA	2.75E-06	mr1029	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221519059	NA	4.42E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221519059	NA	8.01E-06	mr1047	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221519059	NA	5.69E-06	mr1057	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221519059	NA	6.21E-06	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221519059	NA	1.63E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221519059	8.68E-06	5.08E-06	mr1590	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221519059	5.91E-07	2.09E-07	mr1755	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1221519059	7.30E-06	2.46E-06	mr1796	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251