Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220367571:

Variant ID: vg1220367571 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20367571
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGGATTTTTTTTTTGGGAAGCAAAGCAGTGAGATGCAAAAGAGGATAAGGTTGTGCGAAGGATGGGTTAAATCAATGGTGGGCTCCACCGTACGTTTTT[C/G]
TCCGATATTTTTCGTCCCGTCGGATGGCAGATGCAAAGCATTTTCCATGTTGCCAAATGCTTTTCGGATATGGAAATAAGTTTTCGAGTGCTTTGTTTAT

Reverse complement sequence

ATAAACAAAGCACTCGAAAACTTATTTCCATATCCGAAAAGCATTTGGCAACATGGAAAATGCTTTGCATCTGCCATCCGACGGGACGAAAAATATCGGA[G/C]
AAAAACGTACGGTGGAGCCCACCATTGATTTAACCCATCCTTCGCACAACCTTATCCTCTTTTGCATCTCACTGCTTTGCTTCCCAAAAAAAAAATCCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.60%	29.30%	1.06%	16.99%	NA
All Indica	2759	65.50%	10.00%	1.63%	22.94%	NA
All Japonica	1512	29.00%	67.30%	0.00%	3.77%	NA
Aus	269	43.50%	19.00%	1.12%	36.43%	NA
Indica I	595	65.20%	27.20%	4.37%	3.19%	NA
Indica II	465	59.10%	8.00%	1.72%	31.18%	NA
Indica III	913	63.60%	0.90%	0.22%	35.27%	NA
Indica Intermediate	786	71.50%	8.70%	1.15%	18.70%	NA
Temperate Japonica	767	5.50%	94.00%	0.00%	0.52%	NA
Tropical Japonica	504	68.30%	27.80%	0.00%	3.97%	NA
Japonica Intermediate	241	21.60%	64.70%	0.00%	13.69%	NA
VI/Aromatic	96	87.50%	8.30%	0.00%	4.17%	NA
Intermediate	90	46.70%	38.90%	2.22%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220367571	C -> DEL	N	N	silent_mutation	Average:33.4; most accessible tissue: Callus, score: 79.023	N	N	N	N
vg1220367571	C -> G	LOC_Os12g33770.1	upstream_gene_variant ; 3430.0bp to feature; MODIFIER	silent_mutation	Average:33.4; most accessible tissue: Callus, score: 79.023	N	N	N	N
vg1220367571	C -> G	LOC_Os12g33750.1	downstream_gene_variant ; 2223.0bp to feature; MODIFIER	silent_mutation	Average:33.4; most accessible tissue: Callus, score: 79.023	N	N	N	N
vg1220367571	C -> G	LOC_Os12g33760.1	downstream_gene_variant ; 2308.0bp to feature; MODIFIER	silent_mutation	Average:33.4; most accessible tissue: Callus, score: 79.023	N	N	N	N
vg1220367571	C -> G	LOC_Os12g33750-LOC_Os12g33760	intergenic_region ; MODIFIER	silent_mutation	Average:33.4; most accessible tissue: Callus, score: 79.023	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220367571	NA	6.36E-06	mr1304	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571	NA	4.74E-06	mr1308	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571	1.95E-11	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571	4.11E-12	5.09E-27	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571	NA	6.05E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571	9.96E-07	9.96E-07	mr1545	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571	NA	1.46E-07	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571	NA	3.78E-06	mr1614	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571	NA	2.28E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571	NA	2.71E-06	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571	3.77E-09	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571	1.43E-11	6.67E-32	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220367571	1.85E-07	8.22E-14	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251