Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220360743:

Variant ID: vg1220360743 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20360743
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCATGCCAAGTGTCCATTTGGATGACGGTTGGAGCGCCGGAAACGGTCATAACCGTCATTGGGAAGCAGTTATCTACCGAACTGGACTTGGGCCGGGG[T/C]
AAACGGCCTCTGCCAGGGTTTGGCCGAACTCAGGGGTTCGGCTGAACCCGGGACGGCTCCGTTCGCTCCGGTTTTCATCCTGGACACTCATTTTGGGCCC

Reverse complement sequence

GGGCCCAAAATGAGTGTCCAGGATGAAAACCGGAGCGAACGGAGCCGTCCCGGGTTCAGCCGAACCCCTGAGTTCGGCCAAACCCTGGCAGAGGCCGTTT[A/G]
CCCCGGCCCAAGTCCAGTTCGGTAGATAACTGCTTCCCAATGACGGTTATGACCGTTTCCGGCGCTCCAACCGTCATCCAAATGGACACTTGGCATGAGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.20%	21.30%	9.14%	40.33%	NA
All Indica	2759	13.30%	24.10%	12.54%	50.09%	NA
All Japonica	1512	61.20%	20.00%	1.85%	16.93%	NA
Aus	269	15.60%	0.70%	15.24%	68.40%	NA
Indica I	595	33.80%	37.30%	10.59%	18.32%	NA
Indica II	465	11.00%	15.50%	11.40%	62.15%	NA
Indica III	913	2.20%	20.50%	13.36%	63.96%	NA
Indica Intermediate	786	12.10%	23.30%	13.74%	50.89%	NA
Temperate Japonica	767	89.40%	5.10%	0.91%	4.56%	NA
Tropical Japonica	504	23.40%	43.80%	3.77%	28.97%	NA
Japonica Intermediate	241	50.20%	17.80%	0.83%	31.12%	NA
VI/Aromatic	96	9.40%	18.80%	7.29%	64.58%	NA
Intermediate	90	40.00%	24.40%	11.11%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220360743	T -> C	LOC_Os12g33750.1	upstream_gene_variant ; 4222.0bp to feature; MODIFIER	silent_mutation	Average:22.101; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg1220360743	T -> C	LOC_Os12g33730.1	downstream_gene_variant ; 3731.0bp to feature; MODIFIER	silent_mutation	Average:22.101; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg1220360743	T -> C	LOC_Os12g33740.1	downstream_gene_variant ; 1705.0bp to feature; MODIFIER	silent_mutation	Average:22.101; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg1220360743	T -> C	LOC_Os12g33740-LOC_Os12g33750	intergenic_region ; MODIFIER	silent_mutation	Average:22.101; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg1220360743	T -> DEL	N	N	silent_mutation	Average:22.101; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220360743	1.64E-16	2.85E-85	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220360743	5.95E-12	6.97E-24	mr1334	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220360743	4.35E-20	3.18E-97	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220360743	3.47E-06	3.84E-08	mr1334_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220360743	3.50E-10	1.06E-26	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220360743	1.17E-11	1.31E-52	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220360743	5.07E-08	1.57E-14	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251