Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220179248:

Variant ID: vg1220179248 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20179248
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGCGTCTCGCCTTCGTCCAAGGATCGCCGCCGAAGTCGCTCCCTCGCCGTTCGCCTCCGTCGTCTCCGAGCCGTCTCCGCCGTGCTCGTTCGTCTTTGT[T/C]
GTTCCCACGCCTCGTTGCGTGGTGGTAAGGGTCCATCCTCTCGCTGCCCCGTCCTAGTCCTTTCGGTGTCGCCCGTGCCTGTTGTGCGGTTGTCGACCCC

Reverse complement sequence

GGGGTCGACAACCGCACAACAGGCACGGGCGACACCGAAAGGACTAGGACGGGGCAGCGAGAGGATGGACCCTTACCACCACGCAACGAGGCGTGGGAAC[A/G]
ACAAAGACGAACGAGCACGGCGGAGACGGCTCGGAGACGACGGAGGCGAACGGCGAGGGAGCGACTTCGGCGGCGATCCTTGGACGAAGGCGAGACGCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.80%	19.70%	8.78%	1.69%	NA
All Indica	2759	87.60%	4.80%	7.43%	0.18%	NA
All Japonica	1512	33.50%	49.10%	12.50%	4.89%	NA
Aus	269	90.00%	7.80%	2.23%	0.00%	NA
Indica I	595	70.40%	9.40%	20.00%	0.17%	NA
Indica II	465	87.70%	6.20%	5.59%	0.43%	NA
Indica III	913	98.00%	0.90%	1.10%	0.00%	NA
Indica Intermediate	786	88.30%	5.10%	6.36%	0.25%	NA
Temperate Japonica	767	6.60%	66.10%	18.64%	8.60%	NA
Tropical Japonica	504	72.40%	22.80%	4.17%	0.60%	NA
Japonica Intermediate	241	37.30%	50.20%	10.37%	2.07%	NA
VI/Aromatic	96	84.40%	11.50%	4.17%	0.00%	NA
Intermediate	90	60.00%	26.70%	12.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220179248	T -> C	LOC_Os12g33370.1	upstream_gene_variant ; 1251.0bp to feature; MODIFIER	silent_mutation	Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg1220179248	T -> C	LOC_Os12g33360.1	downstream_gene_variant ; 1729.0bp to feature; MODIFIER	silent_mutation	Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg1220179248	T -> C	LOC_Os12g33380.1	downstream_gene_variant ; 4347.0bp to feature; MODIFIER	silent_mutation	Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg1220179248	T -> C	LOC_Os12g33360-LOC_Os12g33370	intergenic_region ; MODIFIER	silent_mutation	Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg1220179248	T -> DEL	N	N	silent_mutation	Average:36.166; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220179248	NA	5.99E-17	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248	1.07E-14	2.19E-100	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248	NA	1.95E-14	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248	7.34E-25	5.53E-125	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248	6.46E-10	6.33E-14	mr1334_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248	NA	7.44E-20	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248	3.19E-10	8.15E-61	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220179248	NA	4.91E-11	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251