| Variant ID: vg1220172445 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 20172445 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 107. )
AAACTCGCAAGGGCACATTTTTTCAGAAGTACAAGTTGAAGGTGGTTCCTGAGGATTTTGGGATCGGTTCATCTAAAGAGGGAGAAAAGAAACAAATTCC[A/G]
GACGGATCAGCCCAGCCGAGTAACAAAGGTGCTACTAATGGCTCTCCAGGAGATCAAGGCGACGACCCTCAAGGGGACCATGGGGTTCAAGGTGACGGCA
TGCCGTCACCTTGAACCCCATGGTCCCCTTGAGGGTCGTCGCCTTGATCTCCTGGAGAGCCATTAGTAGCACCTTTGTTACTCGGCTGGGCTGATCCGTC[T/C]
GGAATTTGTTTCTTTTCTCCCTCTTTAGATGAACCGATCCCAAAATCCTCAGGAACCACCTTCAACTTGTACTTCTGAAAAAATGTGCCCTTGCGAGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.40% | 9.50% | 14.90% | 8.15% | NA |
| All Indica | 2759 | 50.40% | 15.80% | 22.47% | 11.34% | NA |
| All Japonica | 1512 | 93.70% | 0.40% | 3.44% | 2.45% | NA |
| Aus | 269 | 92.20% | 3.30% | 4.46% | 0.00% | NA |
| Indica I | 595 | 53.30% | 4.40% | 28.57% | 13.78% | NA |
| Indica II | 465 | 42.40% | 25.20% | 20.86% | 11.61% | NA |
| Indica III | 913 | 52.70% | 18.70% | 19.72% | 8.87% | NA |
| Indica Intermediate | 786 | 50.40% | 15.40% | 22.01% | 12.21% | NA |
| Temperate Japonica | 767 | 96.20% | 0.00% | 1.30% | 2.48% | NA |
| Tropical Japonica | 504 | 89.90% | 1.00% | 6.55% | 2.58% | NA |
| Japonica Intermediate | 241 | 93.80% | 0.40% | 3.73% | 2.07% | NA |
| VI/Aromatic | 96 | 60.40% | 0.00% | 8.33% | 31.25% | NA |
| Intermediate | 90 | 80.00% | 1.10% | 13.33% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1220172445 | A -> DEL | LOC_Os12g33360.1 | N | frameshift_variant | Average:15.777; most accessible tissue: Callus, score: 46.997 | N | N | N | N |
| vg1220172445 | A -> G | LOC_Os12g33360.1 | synonymous_variant ; p.Pro100Pro; LOW | synonymous_codon | Average:15.777; most accessible tissue: Callus, score: 46.997 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1220172445 | NA | 3.25E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220172445 | 3.79E-06 | 3.79E-06 | mr1105 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220172445 | NA | 4.71E-06 | mr1105_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220172445 | NA | 8.33E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220172445 | NA | 8.67E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220172445 | NA | 3.67E-06 | mr1462_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220172445 | 1.44E-06 | 2.73E-06 | mr1462_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220172445 | NA | 7.99E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1220172445 | NA | 4.85E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |