Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220040338:

Variant ID: vg1220040338 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20040338
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

GTCTACTCTAAGTTTCTCAAGTGTCAAGTTTGAGATCTAGTCTACAGGTCCAGGTCAAACTCGGCTCTGCTCTCTATAGTTTGACTTAGTATGGGTTTGA[G/T]
CTTACCGAGTTCGGGCCTAGGGAGGTTGGAGTCATCAACCAATCAATTTAGTTCGATTACTAGGACGGCAACTACTCTCCTCCACGTGAAACATCATTAA

Reverse complement sequence

TTAATGATGTTTCACGTGGAGGAGAGTAGTTGCCGTCCTAGTAATCGAACTAAATTGATTGGTTGATGACTCCAACCTCCCTAGGCCCGAACTCGGTAAG[C/A]
TCAAACCCATACTAAGTCAAACTATAGAGAGCAGAGCCGAGTTTGACCTGGACCTGTAGACTAGATCTCAAACTTGACACTTGAGAAACTTAGAGTAGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.40%	25.60%	0.06%	0.00%	NA
All Indica	2759	76.90%	23.00%	0.07%	0.00%	NA
All Japonica	1512	69.60%	30.40%	0.00%	0.00%	NA
Aus	269	96.70%	3.30%	0.00%	0.00%	NA
Indica I	595	49.10%	50.80%	0.17%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	79.30%	20.60%	0.11%	0.00%	NA
Indica Intermediate	786	82.70%	17.30%	0.00%	0.00%	NA
Temperate Japonica	767	94.50%	5.50%	0.00%	0.00%	NA
Tropical Japonica	504	27.20%	72.80%	0.00%	0.00%	NA
Japonica Intermediate	241	78.80%	21.20%	0.00%	0.00%	NA
VI/Aromatic	96	19.80%	80.20%	0.00%	0.00%	NA
Intermediate	90	67.80%	31.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220040338	G -> T	LOC_Os12g33120.1	upstream_gene_variant ; 1947.0bp to feature; MODIFIER	silent_mutation	Average:41.91; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg1220040338	G -> T	LOC_Os12g33110.1	intron_variant ; MODIFIER	silent_mutation	Average:41.91; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220040338	NA	2.86E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220040338	NA	5.59E-08	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220040338	4.57E-07	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220040338	2.65E-10	2.02E-25	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220040338	NA	1.71E-09	mr1403	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220040338	NA	1.21E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220040338	8.54E-10	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220040338	1.47E-10	2.94E-31	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220040338	NA	7.30E-07	mr1807_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220040338	2.04E-08	3.54E-15	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251