Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1220015795:

Variant ID: vg1220015795 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 20015795
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.81, A: 0.19, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGCTCAATAGATTCGTCTCGCGAATTAGTCCAAGATTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAATATCTAAACATCCGAT[A/G]
TGATAGGAACTTAAATCTAGTTTTAGTCCCATCTAAACAGAGTCTAAGTCTAATACTTCTTGTATTGTACAGCGGGATGTAGCCACCCACAACTAGTACT

Reverse complement sequence

AGTACTAGTTGTGGGTGGCTACATCCCGCTGTACAATACAAGAAGTATTAGACTTAGACTCTGTTTAGATGGGACTAAAACTAGATTTAAGTTCCTATCA[T/C]
ATCGGATGTTTAGATATTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAATCTTGGACTAATTCGCGAGACGAATCTATTGAGCCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.20%	21.80%	0.04%	0.00%	NA
All Indica	2759	98.60%	1.30%	0.07%	0.00%	NA
All Japonica	1512	42.20%	57.80%	0.00%	0.00%	NA
Aus	269	66.50%	33.50%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	97.00%	2.80%	0.22%	0.00%	NA
Indica III	913	99.20%	0.70%	0.11%	0.00%	NA
Indica Intermediate	786	98.90%	1.10%	0.00%	0.00%	NA
Temperate Japonica	767	14.90%	85.10%	0.00%	0.00%	NA
Tropical Japonica	504	78.20%	21.80%	0.00%	0.00%	NA
Japonica Intermediate	241	53.90%	46.10%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1220015795	A -> G	LOC_Os12g33090.1	upstream_gene_variant ; 2760.0bp to feature; MODIFIER	silent_mutation	Average:97.373; most accessible tissue: Minghui63 panicle, score: 99.044	N	N	N	N
vg1220015795	A -> G	LOC_Os12g33080-LOC_Os12g33090	intergenic_region ; MODIFIER	silent_mutation	Average:97.373; most accessible tissue: Minghui63 panicle, score: 99.044	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1220015795	A	G	0.01	0.01	0.01	0.01	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1220015795	NA	8.12E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220015795	7.64E-25	5.39E-89	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220015795	NA	8.78E-09	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220015795	5.06E-14	1.97E-24	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220015795	NA	4.31E-10	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220015795	2.20E-33	4.79E-102	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220015795	1.81E-09	1.16E-11	mr1334_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220015795	3.87E-15	1.73E-27	mr1334_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220015795	3.00E-13	1.83E-50	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1220015795	1.10E-08	5.25E-14	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251