Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219919758:

Variant ID: vg1219919758 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19919758
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


GCGAGCTCGAGCTCATCCCCTCTGCCACCAAGTTCCTCCCTGTGGTCGCCGGCGAGCTCAAGCTCGTTTCCTCCGCTGTCAAGCTCCTCCACGTGGTCGT[C/T]
GGCGAGCTCAAGCTCGTTTCCTCTGCCGTCAAGCTCCTCCCCGTGGTCGCCGGCAAGCTATCAAGGTGCCGGCGAGGTTGAGTTGCTTCCGTGCCTCCAT

Reverse complement sequence

ATGGAGGCACGGAAGCAACTCAACCTCGCCGGCACCTTGATAGCTTGCCGGCGACCACGGGGAGGAGCTTGACGGCAGAGGAAACGAGCTTGAGCTCGCC[G/A]
ACGACCACGTGGAGGAGCTTGACAGCGGAGGAAACGAGCTTGAGCTCGCCGGCGACCACAGGGAGGAACTTGGTGGCAGAGGGGATGAGCTCGAGCTCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 41.00% 3.34% 2.22% NA
All Indica  2759 82.30% 8.40% 5.58% 3.70% NA
All Japonica  1512 3.00% 96.90% 0.13% 0.00% NA
Aus  269 63.20% 36.40% 0.37% 0.00% NA
Indica I  595 81.80% 2.70% 12.94% 2.52% NA
Indica II  465 89.70% 4.30% 2.15% 3.87% NA
Indica III  913 82.50% 10.80% 2.63% 4.05% NA
Indica Intermediate  786 78.20% 12.20% 5.47% 4.07% NA
Temperate Japonica  767 2.10% 97.80% 0.13% 0.00% NA
Tropical Japonica  504 3.60% 96.20% 0.20% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 85.40% 0.00% 1.04% NA
Intermediate  90 26.70% 70.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219919758 C -> DEL N N silent_mutation Average:80.599; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N
vg1219919758 C -> T LOC_Os12g32980.1 upstream_gene_variant ; 1783.0bp to feature; MODIFIER silent_mutation Average:80.599; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N
vg1219919758 C -> T LOC_Os12g32986.1 downstream_gene_variant ; 1818.0bp to feature; MODIFIER silent_mutation Average:80.599; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N
vg1219919758 C -> T LOC_Os12g32980-LOC_Os12g32986 intergenic_region ; MODIFIER silent_mutation Average:80.599; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1219919758 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219919758 NA 1.29E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 5.49E-10 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 6.40E-10 mr1205_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 3.33E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 4.21E-08 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 6.84E-10 7.40E-13 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 1.12E-23 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 1.35E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 8.69E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 3.74E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 2.21E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 5.15E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 4.64E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 1.54E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 1.11E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 3.45E-24 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 4.63E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 5.17E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219919758 NA 4.19E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251