Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219878412:

Variant ID: vg1219878412 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19878412
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTCCCAAGAGGCCGAGTGGATGGAAGGAGCATGTCAAACTGCTAGGTGTGTTCGGACCTCTTGCTTCCCAACCCAACTCCCTCGTTTTCTACACGTAC[A/G]
TTTTTCAAACTACTAAACGGTGCGTTTTTTGCAAAAAGTTTCTATATGAAAGTTGCTTAAAAAATTTAAATTAATCTATTTTTTTAAAAAAAATAGCTAA

Reverse complement sequence

TTAGCTATTTTTTTTAAAAAAATAGATTAATTTAAATTTTTTAAGCAACTTTCATATAGAAACTTTTTGCAAAAAACGCACCGTTTAGTAGTTTGAAAAA[T/C]
GTACGTGTAGAAAACGAGGGAGTTGGGTTGGGAAGCAAGAGGTCCGAACACACCTAGCAGTTTGACATGCTCCTTCCATCCACTCGGCCTCTTGGGACTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.40%	14.20%	1.25%	46.15%	NA
All Indica	2759	6.20%	21.60%	1.63%	70.61%	NA
All Japonica	1512	95.60%	1.30%	0.53%	2.58%	NA
Aus	269	21.90%	16.40%	1.12%	60.59%	NA
Indica I	595	5.20%	0.50%	2.02%	92.27%	NA
Indica II	465	4.70%	52.30%	1.29%	41.72%	NA
Indica III	913	4.90%	15.20%	1.64%	78.20%	NA
Indica Intermediate	786	9.30%	26.70%	1.53%	62.47%	NA
Temperate Japonica	767	96.70%	1.40%	0.91%	0.91%	NA
Tropical Japonica	504	95.00%	0.40%	0.00%	4.56%	NA
Japonica Intermediate	241	93.40%	2.50%	0.41%	3.73%	NA
VI/Aromatic	96	84.40%	2.10%	1.04%	12.50%	NA
Intermediate	90	63.30%	13.30%	2.22%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219878412	A -> DEL	N	N	silent_mutation	Average:42.59; most accessible tissue: Callus, score: 78.147	N	N	N	N
vg1219878412	A -> G	LOC_Os12g32900.1	downstream_gene_variant ; 1219.0bp to feature; MODIFIER	silent_mutation	Average:42.59; most accessible tissue: Callus, score: 78.147	N	N	N	N
vg1219878412	A -> G	LOC_Os12g32880-LOC_Os12g32900	intergenic_region ; MODIFIER	silent_mutation	Average:42.59; most accessible tissue: Callus, score: 78.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219878412	NA	6.20E-10	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219878412	NA	1.68E-10	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219878412	NA	5.71E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219878412	NA	2.14E-08	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219878412	1.37E-06	1.36E-06	mr1623	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219878412	NA	5.69E-09	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219878412	NA	8.31E-11	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219878412	NA	6.94E-08	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219878412	NA	3.69E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251