Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219727877:

Variant ID: vg1219727877 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19727877
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGCCACCAAGCCACATCAAATAATAGTTGACTACAAATAGATTGTGAGTATGAGTAATAGCATTCCTACACTCCTACAAATACTCCTAAGGCTGCGTTC[G/A]
GGAGTGAGGGTTCCCAACCCTCATTACCTGGCACGCAAAACGGAGCAGTATTTAGTGCGTGATTAATTAAGTATTAGCTAATTTTTTCTAAAAATAGATT

Reverse complement sequence

AATCTATTTTTAGAAAAAATTAGCTAATACTTAATTAATCACGCACTAAATACTGCTCCGTTTTGCGTGCCAGGTAATGAGGGTTGGGAACCCTCACTCC[C/T]
GAACGCAGCCTTAGGAGTATTTGTAGGAGTGTAGGAATGCTATTACTCATACTCACAATCTATTTGTAGTCAACTATTATTTGATGTGGCTTGGTGGCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.10%	4.50%	0.32%	0.00%	NA
All Indica	2759	92.10%	7.40%	0.43%	0.00%	NA
All Japonica	1512	99.50%	0.30%	0.20%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	94.50%	4.90%	0.67%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	87.10%	12.30%	0.66%	0.00%	NA
Indica Intermediate	786	92.20%	7.50%	0.25%	0.00%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219727877	G -> A	LOC_Os12g32680.1	downstream_gene_variant ; 2534.0bp to feature; MODIFIER	silent_mutation	Average:38.936; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N
vg1219727877	G -> A	LOC_Os12g32670-LOC_Os12g32680	intergenic_region ; MODIFIER	silent_mutation	Average:38.936; most accessible tissue: Minghui63 young leaf, score: 55.178	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219727877	NA	1.32E-09	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219727877	NA	8.49E-06	mr1563	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219727877	1.60E-06	1.60E-06	mr1682	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219727877	NA	2.81E-07	mr1686	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219727877	NA	1.24E-11	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251