Variant ID: vg1219727877 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 19727877 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTGCCACCAAGCCACATCAAATAATAGTTGACTACAAATAGATTGTGAGTATGAGTAATAGCATTCCTACACTCCTACAAATACTCCTAAGGCTGCGTTC[G/A]
GGAGTGAGGGTTCCCAACCCTCATTACCTGGCACGCAAAACGGAGCAGTATTTAGTGCGTGATTAATTAAGTATTAGCTAATTTTTTCTAAAAATAGATT
AATCTATTTTTAGAAAAAATTAGCTAATACTTAATTAATCACGCACTAAATACTGCTCCGTTTTGCGTGCCAGGTAATGAGGGTTGGGAACCCTCACTCC[C/T]
GAACGCAGCCTTAGGAGTATTTGTAGGAGTGTAGGAATGCTATTACTCATACTCACAATCTATTTGTAGTCAACTATTATTTGATGTGGCTTGGTGGCAC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.10% | 4.50% | 0.32% | 0.00% | NA |
All Indica | 2759 | 92.10% | 7.40% | 0.43% | 0.00% | NA |
All Japonica | 1512 | 99.50% | 0.30% | 0.20% | 0.00% | NA |
Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 94.50% | 4.90% | 0.67% | 0.00% | NA |
Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Indica III | 913 | 87.10% | 12.30% | 0.66% | 0.00% | NA |
Indica Intermediate | 786 | 92.20% | 7.50% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1219727877 | G -> A | LOC_Os12g32680.1 | downstream_gene_variant ; 2534.0bp to feature; MODIFIER | silent_mutation | Average:38.936; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
vg1219727877 | G -> A | LOC_Os12g32670-LOC_Os12g32680 | intergenic_region ; MODIFIER | silent_mutation | Average:38.936; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1219727877 | NA | 1.32E-09 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219727877 | NA | 8.49E-06 | mr1563 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219727877 | 1.60E-06 | 1.60E-06 | mr1682 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219727877 | NA | 2.81E-07 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219727877 | NA | 1.24E-11 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |