| Variant ID: vg1219062101 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 19062101 |
| Reference Allele: CGGCTCAAGGGG | Alternative Allele: TGGCTCAAGGGG,GGGCTCAAGGGG,C |
| Primary Allele: CGGCTCAAGGGG | Secondary Allele: TGGCTCAAGGGG |
Inferred Ancestral Allele: Not determined.
CCTCCACCCCTCTTTATATGGCACAGTGTGACGGGGGGCCATCAGCCATTGGGCTGGGCGCCCCCGATCAGGGCGCGGGTCAAGGCCCCCTTGAGCCTAA[CGGCTCAAGGGG/TGGCTCAAGGGG,GGGCTCAAGGGG,C]
AGGGAGATCTATCTAACATTCTCCCCCTTGATCTCACTATTTCTTTTAGCTTTTTCTATTCCATCACAGATTTACATATAGAGCATGTTTCATCGTCACG
CGTGACGATGAAACATGCTCTATATGTAAATCTGTGATGGAATAGAAAAAGCTAAAAGAAATAGTGAGATCAAGGGGGAGAATGTTAGATAGATCTCCCT[CCCCTTGAGCCG/CCCCTTGAGCCA,CCCCTTGAGCCC,G]
TTAGGCTCAAGGGGGCCTTGACCCGCGCCCTGATCGGGGGCGCCCAGCCCAATGGCTGATGGCCCCCCGTCACACTGTGCCATATAAAGAGGGGTGGAGG
| Populations | Population Size | Frequency of CGGCTCAAGGGG(primary allele) | Frequency of TGGCTCAAGGGG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 7.60% | 19.76% | 4.66% | GGGCTCAAGGGG: 1.78%; C: 0.04% |
| All Indica | 2759 | 80.20% | 12.30% | 5.91% | 0.72% | GGGCTCAAGGGG: 0.87%; C: 0.04% |
| All Japonica | 1512 | 40.70% | 0.50% | 43.19% | 12.37% | GGGCTCAAGGGG: 3.31% |
| Aus | 269 | 88.80% | 0.70% | 10.04% | 0.00% | GGGCTCAAGGGG: 0.37% |
| Indica I | 595 | 87.70% | 9.60% | 1.85% | 0.84% | NA |
| Indica II | 465 | 80.60% | 0.60% | 15.91% | 1.94% | GGGCTCAAGGGG: 0.86% |
| Indica III | 913 | 77.50% | 18.20% | 2.74% | 0.22% | GGGCTCAAGGGG: 1.31% |
| Indica Intermediate | 786 | 77.20% | 14.40% | 6.74% | 0.51% | GGGCTCAAGGGG: 1.02%; C: 0.13% |
| Temperate Japonica | 767 | 65.40% | 0.30% | 23.34% | 9.00% | GGGCTCAAGGGG: 1.96% |
| Tropical Japonica | 504 | 7.10% | 0.20% | 68.25% | 18.45% | GGGCTCAAGGGG: 5.95% |
| Japonica Intermediate | 241 | 32.00% | 1.70% | 53.94% | 10.37% | GGGCTCAAGGGG: 2.07% |
| VI/Aromatic | 96 | 8.30% | 6.20% | 69.79% | 10.42% | GGGCTCAAGGGG: 5.21% |
| Intermediate | 90 | 57.80% | 6.70% | 26.67% | 3.33% | GGGCTCAAGGGG: 4.44%; C: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219062101 | CGGCTCAAGGGG -> C | LOC_Os12g31640.2 | downstream_gene_variant ; 1126.0bp to feature; MODIFIER | silent_mutation | Average:44.956; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg1219062101 | CGGCTCAAGGGG -> C | LOC_Os12g31650.1 | downstream_gene_variant ; 1831.0bp to feature; MODIFIER | silent_mutation | Average:44.956; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg1219062101 | CGGCTCAAGGGG -> C | LOC_Os12g31640-LOC_Os12g31650 | intergenic_region ; MODIFIER | silent_mutation | Average:44.956; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg1219062101 | CGGCTCAAGGGG -> DEL | N | N | silent_mutation | Average:44.956; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg1219062101 | CGGCTCAAGGGG -> GGGCTCAAGGGG | LOC_Os12g31640.2 | downstream_gene_variant ; 1125.0bp to feature; MODIFIER | silent_mutation | Average:44.956; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg1219062101 | CGGCTCAAGGGG -> GGGCTCAAGGGG | LOC_Os12g31650.1 | downstream_gene_variant ; 1832.0bp to feature; MODIFIER | silent_mutation | Average:44.956; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg1219062101 | CGGCTCAAGGGG -> GGGCTCAAGGGG | LOC_Os12g31640-LOC_Os12g31650 | intergenic_region ; MODIFIER | silent_mutation | Average:44.956; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg1219062101 | CGGCTCAAGGGG -> TGGCTCAAGGGG | LOC_Os12g31640.2 | downstream_gene_variant ; 1125.0bp to feature; MODIFIER | silent_mutation | Average:44.956; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg1219062101 | CGGCTCAAGGGG -> TGGCTCAAGGGG | LOC_Os12g31650.1 | downstream_gene_variant ; 1832.0bp to feature; MODIFIER | silent_mutation | Average:44.956; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| vg1219062101 | CGGCTCAAGGGG -> TGGCTCAAGGGG | LOC_Os12g31640-LOC_Os12g31650 | intergenic_region ; MODIFIER | silent_mutation | Average:44.956; most accessible tissue: Zhenshan97 root, score: 60.612 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219062101 | NA | 5.60E-06 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219062101 | NA | 1.56E-06 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219062101 | NA | 9.36E-06 | mr1171 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219062101 | NA | 6.89E-06 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219062101 | 9.19E-06 | 1.00E-15 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219062101 | NA | 6.86E-08 | mr1509 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219062101 | NA | 7.05E-07 | mr1515 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219062101 | NA | 1.86E-07 | mr1671 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219062101 | NA | 7.45E-06 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219062101 | NA | 5.50E-06 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219062101 | 3.46E-06 | 1.36E-18 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |