| Variant ID: vg1218866013 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18866013 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAGCCCACCGTGCTCCCGCCTTAGAATAAGTTTATTTGGCCACCCTCATCTTTTGGGTCGTGCCTATATGGAAGGAATAAGTCTATTTTAACTCCCTAAT[C/T]
GTTGGACCGTGCTATGCCAAGCCGGCCCACTGTGTCAAGGCAGAGGCCTAGGCACAACCCAATGGTCGAGCCGGGGTGACACGGTCACACGGGCCCGACA
TGTCGGGCCCGTGTGACCGTGTCACCCCGGCTCGACCATTGGGTTGTGCCTAGGCCTCTGCCTTGACACAGTGGGCCGGCTTGGCATAGCACGGTCCAAC[G/A]
ATTAGGGAGTTAAAATAGACTTATTCCTTCCATATAGGCACGACCCAAAAGATGAGGGTGGCCAAATAAACTTATTCTAAGGCGGGAGCACGGTGGGCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.20% | 10.40% | 0.85% | 35.59% | NA |
| All Indica | 2759 | 26.40% | 12.30% | 1.30% | 60.06% | NA |
| All Japonica | 1512 | 93.40% | 5.80% | 0.20% | 0.60% | NA |
| Aus | 269 | 81.80% | 17.80% | 0.00% | 0.37% | NA |
| Indica I | 595 | 21.20% | 7.90% | 2.02% | 68.91% | NA |
| Indica II | 465 | 34.20% | 2.40% | 1.08% | 62.37% | NA |
| Indica III | 913 | 23.40% | 16.90% | 0.77% | 58.93% | NA |
| Indica Intermediate | 786 | 29.00% | 16.20% | 1.53% | 53.31% | NA |
| Temperate Japonica | 767 | 98.00% | 1.00% | 0.26% | 0.65% | NA |
| Tropical Japonica | 504 | 94.40% | 5.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 76.30% | 22.80% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 87.50% | 11.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 76.70% | 6.70% | 1.11% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218866013 | C -> DEL | N | N | silent_mutation | Average:41.665; most accessible tissue: Callus, score: 75.927 | N | N | N | N |
| vg1218866013 | C -> T | LOC_Os12g31350-LOC_Os12g31370 | intergenic_region ; MODIFIER | silent_mutation | Average:41.665; most accessible tissue: Callus, score: 75.927 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218866013 | 3.98E-06 | 2.39E-08 | mr1060 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218866013 | NA | 3.16E-06 | mr1171 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218866013 | 2.16E-06 | NA | mr1361 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218866013 | NA | 8.11E-09 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218866013 | NA | 7.56E-06 | mr1509 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218866013 | 7.99E-06 | 7.99E-06 | mr1682 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218866013 | NA | 5.88E-12 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |