Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218850297:

Variant ID: vg1218850297 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18850297
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.02, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:

AATATTATATATGGGTACCGACAACAAAGAAGACACTGAAATCATATATCAACTTCAATATTATTGCTATAACCAAGAGAGGTTCCCCAGAAACACATCT[A/G]
CCACTGCACACACGCAAAGAACAGATGGACATTGATTTCAGATTCAGAAAGAAACAAGAACAAACTGACACGGGATGACTCAAGCAAATTAGCTGTAGTT

Reverse complement sequence

AACTACAGCTAATTTGCTTGAGTCATCCCGTGTCAGTTTGTTCTTGTTTCTTTCTGAATCTGAAATCAATGTCCATCTGTTCTTTGCGTGTGTGCAGTGG[T/C]
AGATGTGTTTCTGGGGAACCTCTCTTGGTTATAGCAATAATATTGAAGTTGATATATGATTTCAGTGTCTTCTTTGTTGTCGGTACCCATATATAATATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.90%	35.10%	0.47%	1.50%	NA
All Indica	2759	71.10%	27.40%	0.18%	1.23%	NA
All Japonica	1512	56.30%	43.70%	0.00%	0.00%	NA
Aus	269	16.70%	75.10%	2.97%	5.20%	NA
Indica I	595	75.80%	24.20%	0.00%	0.00%	NA
Indica II	465	84.10%	15.70%	0.00%	0.22%	NA
Indica III	913	66.80%	30.10%	0.44%	2.63%	NA
Indica Intermediate	786	65.00%	33.70%	0.13%	1.15%	NA
Temperate Japonica	767	36.00%	64.00%	0.00%	0.00%	NA
Tropical Japonica	504	91.30%	8.70%	0.00%	0.00%	NA
Japonica Intermediate	241	48.10%	51.90%	0.00%	0.00%	NA
VI/Aromatic	96	66.70%	9.40%	4.17%	19.79%	NA
Intermediate	90	54.40%	35.60%	5.56%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218850297	A -> DEL	N	N	silent_mutation	Average:44.869; most accessible tissue: Callus, score: 86.276	N	N	N	N
vg1218850297	A -> G	LOC_Os12g31330.1	upstream_gene_variant ; 2676.0bp to feature; MODIFIER	silent_mutation	Average:44.869; most accessible tissue: Callus, score: 86.276	N	N	N	N
vg1218850297	A -> G	LOC_Os12g31320.1	downstream_gene_variant ; 4629.0bp to feature; MODIFIER	silent_mutation	Average:44.869; most accessible tissue: Callus, score: 86.276	N	N	N	N
vg1218850297	A -> G	LOC_Os12g31340.1	downstream_gene_variant ; 768.0bp to feature; MODIFIER	silent_mutation	Average:44.869; most accessible tissue: Callus, score: 86.276	N	N	N	N
vg1218850297	A -> G	LOC_Os12g31330-LOC_Os12g31340	intergenic_region ; MODIFIER	silent_mutation	Average:44.869; most accessible tissue: Callus, score: 86.276	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218850297	NA	4.75E-06	mr1171	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297	NA	6.62E-10	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297	5.36E-07	NA	mr1458	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297	NA	1.06E-12	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297	NA	2.35E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297	NA	3.89E-06	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297	7.03E-09	NA	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297	NA	9.22E-11	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218850297	NA	1.03E-06	mr1458_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251