Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218849677:

Variant ID: vg1218849677 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18849677
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TAATTAATGACATGACATGAACACATGAGACATCTGTAGAGAACCAACAGTGCACACAGAATTGCATGAACAAACTAACGAGACGGGTGTACTGAGCGCC[A/G]
CTACTCGCATGAGCAACTTTTGTCGTGTGAACTATGAACTATTTATAGGCTGAGCATCAGGATAGTATTGCTTAGTATACCACATGATGGAGAGCTAGAG

Reverse complement sequence

CTCTAGCTCTCCATCATGTGGTATACTAAGCAATACTATCCTGATGCTCAGCCTATAAATAGTTCATAGTTCACACGACAAAAGTTGCTCATGCGAGTAG[T/C]
GGCGCTCAGTACACCCGTCTCGTTAGTTTGTTCATGCAATTCTGTGTGCACTGTTGGTTCTCTACAGATGTCTCATGTGTTCATGTCATGTCATTAATTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.00%	37.10%	0.44%	0.55%	NA
All Indica	2759	69.60%	29.30%	0.47%	0.62%	NA
All Japonica	1512	56.00%	43.90%	0.07%	0.00%	NA
Aus	269	16.40%	81.80%	1.49%	0.37%	NA
Indica I	595	75.50%	24.40%	0.17%	0.00%	NA
Indica II	465	82.40%	17.00%	0.65%	0.00%	NA
Indica III	913	65.50%	32.50%	0.66%	1.31%	NA
Indica Intermediate	786	62.50%	36.50%	0.38%	0.64%	NA
Temperate Japonica	767	35.60%	64.40%	0.00%	0.00%	NA
Tropical Japonica	504	90.90%	8.90%	0.20%	0.00%	NA
Japonica Intermediate	241	48.10%	51.90%	0.00%	0.00%	NA
VI/Aromatic	96	66.70%	22.90%	2.08%	8.33%	NA
Intermediate	90	57.80%	41.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218849677	A -> DEL	N	N	silent_mutation	Average:50.287; most accessible tissue: Callus, score: 89.583	N	N	N	N
vg1218849677	A -> G	LOC_Os12g31330.1	upstream_gene_variant ; 2056.0bp to feature; MODIFIER	silent_mutation	Average:50.287; most accessible tissue: Callus, score: 89.583	N	N	N	N
vg1218849677	A -> G	LOC_Os12g31320.1	downstream_gene_variant ; 4009.0bp to feature; MODIFIER	silent_mutation	Average:50.287; most accessible tissue: Callus, score: 89.583	N	N	N	N
vg1218849677	A -> G	LOC_Os12g31340.1	downstream_gene_variant ; 1388.0bp to feature; MODIFIER	silent_mutation	Average:50.287; most accessible tissue: Callus, score: 89.583	N	N	N	N
vg1218849677	A -> G	LOC_Os12g31330-LOC_Os12g31340	intergenic_region ; MODIFIER	silent_mutation	Average:50.287; most accessible tissue: Callus, score: 89.583	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218849677	NA	4.09E-06	mr1171	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677	NA	1.79E-08	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677	5.18E-06	NA	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677	NA	7.16E-11	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677	NA	6.79E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677	NA	2.53E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677	NA	7.40E-06	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677	4.96E-09	NA	mr1458_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677	NA	1.77E-09	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218849677	NA	4.90E-07	mr1458_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251