| Variant ID: vg1218825117 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18825117 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTACGGTTGGTACTCACCCTTGCAATATACAAACTTAACCAGAGATCGGAGATGAAGCTCCAGAGGATCCCTACGCTTACTACCAGGAGGGTGATGAAGA[C/T]
GATGGCGCTCAATAGGTCTTAGTTATGGTCGTTGCCTGTGGCAATGACGTGCCGCTGCCTTAACTCCGTTGCCTTATCTACTTCTGTTTTTGGAATGTAT
ATACATTCCAAAAACAGAAGTAGATAAGGCAACGGAGTTAAGGCAGCGGCACGTCATTGCCACAGGCAACGACCATAACTAAGACCTATTGAGCGCCATC[G/A]
TCTTCATCACCCTCCTGGTAGTAAGCGTAGGGATCCTCTGGAGCTTCATCTCCGATCTCTGGTTAAGTTTGTATATTGCAAGGGTGAGTACCAACCGTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.00% | 2.50% | 11.43% | 10.03% | NA |
| All Indica | 2759 | 76.20% | 0.20% | 13.95% | 9.60% | NA |
| All Japonica | 1512 | 82.90% | 7.30% | 5.03% | 4.83% | NA |
| Aus | 269 | 27.10% | 0.00% | 26.39% | 46.47% | NA |
| Indica I | 595 | 79.50% | 0.50% | 8.74% | 11.26% | NA |
| Indica II | 465 | 88.80% | 0.20% | 5.59% | 5.38% | NA |
| Indica III | 913 | 72.30% | 0.00% | 19.82% | 7.89% | NA |
| Indica Intermediate | 786 | 70.90% | 0.30% | 16.03% | 12.85% | NA |
| Temperate Japonica | 767 | 89.40% | 3.80% | 6.00% | 0.78% | NA |
| Tropical Japonica | 504 | 79.80% | 13.10% | 4.17% | 2.98% | NA |
| Japonica Intermediate | 241 | 68.50% | 6.20% | 3.73% | 21.58% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 4.17% | 6.25% | NA |
| Intermediate | 90 | 87.80% | 2.20% | 4.44% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218825117 | C -> DEL | LOC_Os12g31280.1 | N | frameshift_variant | Average:28.687; most accessible tissue: Minghui63 young leaf, score: 44.63 | N | N | N | N |
| vg1218825117 | C -> T | LOC_Os12g31280.1 | missense_variant ; p.Thr17Met; MODERATE | nonsynonymous_codon ; T17M | Average:28.687; most accessible tissue: Minghui63 young leaf, score: 44.63 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218825117 | NA | 4.69E-06 | mr1110_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218825117 | 3.00E-06 | 3.00E-06 | mr1302_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218825117 | NA | 7.90E-07 | mr1482_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218825117 | NA | 6.38E-06 | mr1715_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218825117 | NA | 5.28E-06 | mr1813_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218825117 | NA | 1.46E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |