Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218590374:

Variant ID: vg1218590374 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18590374
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAAACGATTTACTTCGATAAAAACAATTTCTCTACTTCCGACCCCACCCCACATCTCAACAATATTTATAACACTATGTTGATGAAAAATCCGCGCTC[A/C,T]
GCCGATGGTGCCTAGTCTGTGTTGGCGCGAACTAAGTCGACAAACACAACGGCCAGAGAGATCTGCTTAGTTCTAGTGCAGGTCCAAAGGTTGATGAGAT

Reverse complement sequence

ATCTCATCAACCTTTGGACCTGCACTAGAACTAAGCAGATCTCTCTGGCCGTTGTGTTTGTCGACTTAGTTCGCGCCAACACAGACTAGGCACCATCGGC[T/G,A]
GAGCGCGGATTTTTCATCAACATAGTGTTATAAATATTGTTGAGATGTGGGGTGGGGTCGGAAGTAGAGAAATTGTTTTTATCGAAGTAAATCGTTTACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 32.80% 0.15% 0.00% T: 0.04%
All Indica  2759 44.60% 55.10% 0.25% 0.00% T: 0.07%
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 64.40% 35.50% 0.17% 0.00% NA
Indica II  465 33.10% 66.90% 0.00% 0.00% NA
Indica III  913 40.10% 59.60% 0.33% 0.00% NA
Indica Intermediate  786 41.60% 57.80% 0.38% 0.00% T: 0.25%
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218590374 A -> C LOC_Os12g30950.1 upstream_gene_variant ; 2420.0bp to feature; MODIFIER silent_mutation Average:39.754; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg1218590374 A -> C LOC_Os12g30960.1 downstream_gene_variant ; 2099.0bp to feature; MODIFIER silent_mutation Average:39.754; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg1218590374 A -> C LOC_Os12g30950-LOC_Os12g30960 intergenic_region ; MODIFIER silent_mutation Average:39.754; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg1218590374 A -> T LOC_Os12g30950.1 upstream_gene_variant ; 2420.0bp to feature; MODIFIER silent_mutation Average:39.754; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg1218590374 A -> T LOC_Os12g30960.1 downstream_gene_variant ; 2099.0bp to feature; MODIFIER silent_mutation Average:39.754; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg1218590374 A -> T LOC_Os12g30950-LOC_Os12g30960 intergenic_region ; MODIFIER silent_mutation Average:39.754; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218590374 NA 1.15E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590374 4.52E-10 9.94E-21 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590374 6.40E-08 9.29E-12 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590374 2.55E-14 3.11E-54 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590374 8.82E-11 3.54E-17 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590374 NA 4.94E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590374 1.08E-11 3.04E-30 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590374 2.71E-09 4.12E-14 mr1457_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590374 1.70E-18 4.04E-61 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590374 5.83E-16 3.29E-22 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218590374 NA 3.56E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251