Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218589977:

Variant ID: vg1218589977 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18589977
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

ACATTCTCTCTAGGTGCCCATTCAGAACCCGGCACCAACGTGTATGAGCACTAGTGCCGACTAATATGTGCAGTATAGCCAGTTCCCAACCGGCTCTTAC[G/A]
ATGGTTTCTGTACTAGTGTTGGTGTATGCCTAAGTGACATGAATTAATATCATTAACATGATACACAAGTAGTTGTAATATGGTCTTAGTTTTCGATAAA

Reverse complement sequence

TTTATCGAAAACTAAGACCATATTACAACTACTTGTGTATCATGTTAATGATATTAATTCATGTCACTTAGGCATACACCAACACTAGTACAGAAACCAT[C/T]
GTAAGAGCCGGTTGGGAACTGGCTATACTGCACATATTAGTCGGCACTAGTGCTCATACACGTTGGTGCCGGGTTCTGAATGGGCACCTAGAGAGAATGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	33.30%	0.19%	0.00%	NA
All Indica	2759	44.30%	55.50%	0.22%	0.00%	NA
All Japonica	1512	98.80%	1.10%	0.13%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	64.00%	35.80%	0.17%	0.00%	NA
Indica II	465	32.90%	66.90%	0.22%	0.00%	NA
Indica III	913	39.60%	60.10%	0.22%	0.00%	NA
Indica Intermediate	786	41.30%	58.40%	0.25%	0.00%	NA
Temperate Japonica	767	98.80%	1.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.50%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	20.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218589977	G -> A	LOC_Os12g30950.1	upstream_gene_variant ; 2023.0bp to feature; MODIFIER	silent_mutation	Average:44.975; most accessible tissue: Callus, score: 77.388	N	N	N	N
vg1218589977	G -> A	LOC_Os12g30960.1	downstream_gene_variant ; 2496.0bp to feature; MODIFIER	silent_mutation	Average:44.975; most accessible tissue: Callus, score: 77.388	N	N	N	N
vg1218589977	G -> A	LOC_Os12g30950-LOC_Os12g30960	intergenic_region ; MODIFIER	silent_mutation	Average:44.975; most accessible tissue: Callus, score: 77.388	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218589977	NA	1.82E-06	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977	8.57E-10	3.20E-20	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977	1.59E-07	2.75E-11	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977	2.92E-13	5.51E-51	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977	4.06E-10	4.38E-16	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977	NA	4.02E-07	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977	4.13E-11	5.83E-29	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977	2.15E-09	6.93E-14	mr1457_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977	6.78E-17	4.32E-57	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218589977	7.18E-16	2.72E-21	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251