Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218585338:

Variant ID: vg1218585338 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18585338
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCTCGGTATGATAGGCTGTCTCAGCACGTTCTGTTCAACGATCAGGGAAGCGAAGTAGTTGAGGAAGCTAAGATAGACAATTTCAGCCATATAAAACA[C/T]
GGCCCAAAGAGTTGATGGATGCAAAATTGACTTATTCCAGCGAGGCAAAATAGTTGAGGCCCGTGAAAATCACTTATTCTGTTGCTCTGCCGCTTGAAAA

Reverse complement sequence

TTTTCAAGCGGCAGAGCAACAGAATAAGTGATTTTCACGGGCCTCAACTATTTTGCCTCGCTGGAATAAGTCAATTTTGCATCCATCAACTCTTTGGGCC[G/A]
TGTTTTATATGGCTGAAATTGTCTATCTTAGCTTCCTCAACTACTTCGCTTCCCTGATCGTTGAACAGAACGTGCTGAGACAGCCTATCATACCGAGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 33.10% 0.06% 0.00% NA
All Indica  2759 44.50% 55.40% 0.07% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 64.70% 35.30% 0.00% 0.00% NA
Indica II  465 32.70% 67.10% 0.22% 0.00% NA
Indica III  913 39.40% 60.60% 0.00% 0.00% NA
Indica Intermediate  786 42.10% 57.80% 0.13% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218585338 C -> T LOC_Os12g30940.1 upstream_gene_variant ; 412.0bp to feature; MODIFIER silent_mutation Average:66.698; most accessible tissue: Callus, score: 97.738 N N N N
vg1218585338 C -> T LOC_Os12g30920.1 downstream_gene_variant ; 4837.0bp to feature; MODIFIER silent_mutation Average:66.698; most accessible tissue: Callus, score: 97.738 N N N N
vg1218585338 C -> T LOC_Os12g30930.1 downstream_gene_variant ; 3296.0bp to feature; MODIFIER silent_mutation Average:66.698; most accessible tissue: Callus, score: 97.738 N N N N
vg1218585338 C -> T LOC_Os12g30950.1 downstream_gene_variant ; 1026.0bp to feature; MODIFIER silent_mutation Average:66.698; most accessible tissue: Callus, score: 97.738 N N N N
vg1218585338 C -> T LOC_Os12g30940-LOC_Os12g30950 intergenic_region ; MODIFIER silent_mutation Average:66.698; most accessible tissue: Callus, score: 97.738 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218585338 NA 1.21E-11 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218585338 4.32E-06 NA mr1495 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218585338 2.15E-06 4.39E-23 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218585338 6.89E-09 1.62E-48 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251