| Variant ID: vg1218543377 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18543377 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACATCATGTCAACCATGCGTCGCGATATTTAACAAGTACCCAAATAGAGATTGTAACAATACCCTCCGCATAACACAATTCAAAGCAGTGCACCATTCCT[G/A]
GATCATAATCACCCCCTTATAAAACAAGGCATGGACTCCCCAGCGACCCCTGTGGGCTTATCTCCGCCACTTCTCTGTCTGGTGCCCCACGATGAACCAC
GTGGTTCATCGTGGGGCACCAGACAGAGAAGTGGCGGAGATAAGCCCACAGGGGTCGCTGGGGAGTCCATGCCTTGTTTTATAAGGGGGTGATTATGATC[C/T]
AGGAATGGTGCACTGCTTTGAATTGTGTTATGCGGAGGGTATTGTTACAATCTCTATTTGGGTACTTGTTAAATATCGCGACGCATGGTTGACATGATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 15.90% | 0.20% | 1.90% | 82.01% | NA |
| All Indica | 2759 | 5.70% | 0.20% | 1.92% | 92.24% | NA |
| All Japonica | 1512 | 37.40% | 0.00% | 1.39% | 61.24% | NA |
| Aus | 269 | 0.70% | 0.40% | 4.09% | 94.80% | NA |
| Indica I | 595 | 8.70% | 0.00% | 0.67% | 90.59% | NA |
| Indica II | 465 | 5.60% | 0.60% | 0.65% | 93.12% | NA |
| Indica III | 913 | 2.40% | 0.10% | 3.07% | 94.41% | NA |
| Indica Intermediate | 786 | 7.10% | 0.10% | 2.29% | 90.46% | NA |
| Temperate Japonica | 767 | 62.80% | 0.00% | 1.69% | 35.46% | NA |
| Tropical Japonica | 504 | 4.00% | 0.00% | 1.19% | 94.84% | NA |
| Japonica Intermediate | 241 | 26.10% | 0.00% | 0.83% | 73.03% | NA |
| VI/Aromatic | 96 | 2.10% | 2.10% | 4.17% | 91.67% | NA |
| Intermediate | 90 | 30.00% | 0.00% | 1.11% | 68.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218543377 | G -> DEL | N | N | silent_mutation | Average:6.34; most accessible tissue: Zhenshan97 root, score: 12.891 | N | N | N | N |
| vg1218543377 | G -> A | LOC_Os12g30880.1 | downstream_gene_variant ; 2726.0bp to feature; MODIFIER | silent_mutation | Average:6.34; most accessible tissue: Zhenshan97 root, score: 12.891 | N | N | N | N |
| vg1218543377 | G -> A | LOC_Os12g30850-LOC_Os12g30880 | intergenic_region ; MODIFIER | silent_mutation | Average:6.34; most accessible tissue: Zhenshan97 root, score: 12.891 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218543377 | NA | 1.22E-07 | mr1308 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218543377 | NA | 1.60E-07 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218543377 | 4.21E-06 | NA | mr1574 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218543377 | NA | 3.70E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218543377 | NA | 3.76E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218543377 | 3.79E-06 | NA | mr1677 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |