Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218529611:

Variant ID: vg1218529611 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18529611
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACACACCCTAAATCTCAACCCTCGTGGCGCATAGGCTAAAATTATGGAAAGTAACCTGTGCAATCAATCCTATTTATTCTTTTCTTCCGTAATTTTCT[A/G]
ATCTATGCAGATTAGGAGCAAAAGGGACAGTCCCTAATTTCAAATGTTGATTAGGATTATTCATGTGGCATATTAAGTTGGTCCAAAGATGATTTAAATA

Reverse complement sequence

TATTTAAATCATCTTTGGACCAACTTAATATGCCACATGAATAATCCTAATCAACATTTGAAATTAGGGACTGTCCCTTTTGCTCCTAATCTGCATAGAT[T/C]
AGAAAATTACGGAAGAAAAGAATAAATAGGATTGATTGCACAGGTTACTTTCCATAATTTTAGCCTATGCGCCACGAGGGTTGAGATTTAGGGTGTGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	29.60%	0.78%	7.79%	NA
All Indica	2759	83.10%	12.10%	0.69%	4.06%	NA
All Japonica	1512	35.40%	59.40%	0.53%	4.63%	NA
Aus	269	15.20%	16.00%	2.60%	66.17%	NA
Indica I	595	89.10%	5.50%	0.17%	5.21%	NA
Indica II	465	97.20%	2.40%	0.22%	0.22%	NA
Indica III	913	75.80%	18.90%	1.53%	3.72%	NA
Indica Intermediate	786	78.80%	15.00%	0.38%	5.85%	NA
Temperate Japonica	767	59.10%	39.60%	0.91%	0.39%	NA
Tropical Japonica	504	4.60%	91.70%	0.00%	3.77%	NA
Japonica Intermediate	241	24.90%	54.80%	0.41%	19.92%	NA
VI/Aromatic	96	2.10%	92.70%	0.00%	5.21%	NA
Intermediate	90	54.40%	38.90%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218529611	A -> DEL	N	N	silent_mutation	Average:40.435; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg1218529611	A -> G	LOC_Os12g30824.1	upstream_gene_variant ; 911.0bp to feature; MODIFIER	silent_mutation	Average:40.435; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg1218529611	A -> G	LOC_Os12g30824.2	upstream_gene_variant ; 911.0bp to feature; MODIFIER	silent_mutation	Average:40.435; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg1218529611	A -> G	LOC_Os12g30840.1	downstream_gene_variant ; 1822.0bp to feature; MODIFIER	silent_mutation	Average:40.435; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg1218529611	A -> G	LOC_Os12g30824-LOC_Os12g30840	intergenic_region ; MODIFIER	silent_mutation	Average:40.435; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218529611	NA	8.68E-06	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611	NA	5.71E-08	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611	1.15E-06	8.58E-43	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611	6.33E-15	2.08E-28	mr1458	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611	NA	3.05E-07	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611	NA	7.32E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611	NA	1.59E-15	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611	NA	2.10E-08	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218529611	1.59E-20	7.40E-40	mr1458_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251