RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1218129212:

Variant ID: vg1218129212 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18129212
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.86, T: 0.14, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTGAAGGCTGTCTTGGAGATATCCTCTTCCCGAATCCTCAACTGGTGGTAGCCTGATCGCAGGTCTATTTTGGAAAACACCTTGGCTCCTTTCAGCTG[T/A]
TCGAACAGATCATCAATCCGCGGTAAAGGATATTTGTTCTTGATTGTGACCTCATTGAGTGCGCGATAATCGACACACATTCTCTTCGTCTTGTCCTTCT

Reverse complement sequence

AGAAGGACAAGACGAAGAGAATGTGTGTCGATTATCGCGCACTCAATGAGGTCACAATCAAGAACAAATATCCTTTACCGCGGATTGATGATCTGTTCGA[A/T]
CAGCTGAAAGGAGCCAAGGTGTTTTCCAAAATAGACCTGCGATCAGGCTACCACCAGTTGAGGATTCGGGAAGAGGATATCTCCAAGACAGCCTTCACTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.40%	33.30%	2.92%	20.40%	NA
All Indica	2759	59.30%	4.80%	4.78%	31.06%	NA
All Japonica	1512	13.60%	86.00%	0.00%	0.33%	NA
Aus	269	58.70%	8.20%	1.12%	31.97%	NA
Indica I	595	87.90%	5.40%	0.34%	6.39%	NA
Indica II	465	51.60%	3.70%	2.58%	42.15%	NA
Indica III	913	50.10%	1.60%	9.31%	38.99%	NA
Indica Intermediate	786	53.10%	8.80%	4.20%	33.97%	NA
Temperate Japonica	767	1.00%	98.40%	0.00%	0.52%	NA
Tropical Japonica	504	24.60%	75.40%	0.00%	0.00%	NA
Japonica Intermediate	241	30.70%	68.90%	0.00%	0.41%	NA
VI/Aromatic	96	22.90%	68.80%	1.04%	7.29%	NA
Intermediate	90	28.90%	58.90%	2.22%	10.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218129212	T -> DEL	LOC_Os12g30200.1	N	frameshift_variant	Average:38.545; most accessible tissue: Minghui63 flag leaf, score: 65.44	N	N	N	N
vg1218129212	T -> A	LOC_Os12g30200.1	missense_variant ; p.Glu368Asp; MODERATE	nonsynonymous_codon ; E368D	Average:38.545; most accessible tissue: Minghui63 flag leaf, score: 65.44	benign	-1.241	TOLERATED	1.00

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218129212	NA	9.74E-08	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212	NA	5.74E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212	2.31E-06	NA	mr1230	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212	NA	1.39E-08	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212	NA	1.91E-18	mr1304	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212	NA	3.37E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212	NA	1.06E-09	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212	NA	2.38E-15	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212	NA	2.38E-15	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218129212	NA	1.88E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 25 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg1218129212:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact