Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218117927:

Variant ID: vg1218117927 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18117927
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

CCCAGTTACTCCAGTTGTAGATTGGGTATAAATAAATCATCTCTTACTATAAAATTATTTTATAGATCACTAATTCCTAAAATTTAACATGCAAACATAT[C/T]
ATATCATCATCAACTAATAATTATAATAATTATAGTCGATATACCGAGTTTTCATTGCAAACCCCCAAGATATTATTACTACATACTAAGGATAACAACA

Reverse complement sequence

TGTTGTTATCCTTAGTATGTAGTAATAATATCTTGGGGGTTTGCAATGAAAACTCGGTATATCGACTATAATTATTATAATTATTAGTTGATGATGATAT[G/A]
ATATGTTTGCATGTTAAATTTTAGGAATTAGTGATCTATAAAATAATTTTATAGTAAGAGATGATTTATTTATACCCAATCTACAACTGGAGTAACTGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.00%	5.00%	0.25%	18.68%	NA
All Indica	2759	95.60%	2.20%	0.04%	2.17%	NA
All Japonica	1512	43.90%	7.20%	0.40%	48.48%	NA
Aus	269	71.40%	22.70%	0.00%	5.95%	NA
Indica I	595	98.20%	0.20%	0.00%	1.68%	NA
Indica II	465	90.30%	9.20%	0.00%	0.43%	NA
Indica III	913	97.50%	0.30%	0.00%	2.19%	NA
Indica Intermediate	786	94.70%	1.70%	0.13%	3.56%	NA
Temperate Japonica	767	65.40%	0.10%	0.26%	34.16%	NA
Tropical Japonica	504	8.10%	19.40%	0.60%	71.83%	NA
Japonica Intermediate	241	50.20%	4.10%	0.41%	45.23%	NA
VI/Aromatic	96	32.30%	6.20%	1.04%	60.42%	NA
Intermediate	90	75.60%	2.20%	4.44%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218117927	C -> DEL	N	N	silent_mutation	Average:46.327; most accessible tissue: Callus, score: 74.243	N	N	N	N
vg1218117927	C -> T	LOC_Os12g30170.1	downstream_gene_variant ; 4192.0bp to feature; MODIFIER	silent_mutation	Average:46.327; most accessible tissue: Callus, score: 74.243	N	N	N	N
vg1218117927	C -> T	LOC_Os12g30190.1	downstream_gene_variant ; 3816.0bp to feature; MODIFIER	silent_mutation	Average:46.327; most accessible tissue: Callus, score: 74.243	N	N	N	N
vg1218117927	C -> T	LOC_Os12g30180.1	intron_variant ; MODIFIER	silent_mutation	Average:46.327; most accessible tissue: Callus, score: 74.243	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218117927	NA	2.14E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218117927	NA	3.50E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218117927	NA	1.08E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218117927	3.58E-07	NA	mr1364	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218117927	NA	2.53E-08	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218117927	NA	8.81E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218117927	NA	2.21E-07	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218117927	NA	6.96E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218117927	1.14E-06	NA	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218117927	NA	9.68E-08	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218117927	3.59E-06	3.59E-06	mr1856	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251