Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218068686:

Variant ID: vg1218068686 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18068686
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, C: 0.07, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CAATCACAGATCACGCGGGTAGGGCAGGGACCAGCCACCATCCAGGCAGCCGGCAAGAAGCGTCGACAGCGATACCGCCTTGGTGGCTTGGCCGATGGGC[C/G]
ACGGCGATCAGGCGCTATAGGCTAGTGGGGCCGATGCGGTCTTGGCACTCACGGCGGCCTCTCGCGGACTAGGGCATCGGCGAGACGGCGACGAAGCGAC

Reverse complement sequence

GTCGCTTCGTCGCCGTCTCGCCGATGCCCTAGTCCGCGAGAGGCCGCCGTGAGTGCCAAGACCGCATCGGCCCCACTAGCCTATAGCGCCTGATCGCCGT[G/C]
GCCCATCGGCCAAGCCACCAAGGCGGTATCGCTGTCGACGCTTCTTGCCGGCTGCCTGGATGGTGGCTGGTCCCTGCCCTACCCGCGTGATCTGTGATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 39.30% 0.17% 0.00% NA
All Indica  2759 72.40% 27.40% 0.25% 0.00% NA
All Japonica  1512 48.60% 51.30% 0.07% 0.00% NA
Aus  269 25.30% 74.70% 0.00% 0.00% NA
Indica I  595 84.00% 15.60% 0.34% 0.00% NA
Indica II  465 67.70% 32.00% 0.22% 0.00% NA
Indica III  913 68.50% 31.30% 0.22% 0.00% NA
Indica Intermediate  786 70.90% 28.90% 0.25% 0.00% NA
Temperate Japonica  767 64.00% 36.00% 0.00% 0.00% NA
Tropical Japonica  504 26.40% 73.60% 0.00% 0.00% NA
Japonica Intermediate  241 46.10% 53.50% 0.41% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218068686 C -> G LOC_Os12g30130.1 intron_variant ; MODIFIER silent_mutation Average:75.753; most accessible tissue: Zhenshan97 young leaf, score: 89.772 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218068686 C G -0.12 -0.11 -0.06 -0.19 -0.15 -0.14

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218068686 NA 2.52E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 1.40E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 9.03E-06 mr1171 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 7.21E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 1.44E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 5.84E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 1.90E-06 NA mr1285 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 3.20E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 6.43E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 3.36E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 1.00E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 7.22E-06 NA mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 1.58E-06 mr1492 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 7.51E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 2.97E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 9.64E-06 NA mr1519 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 7.78E-08 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 9.88E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 3.48E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 3.50E-06 NA mr1647 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 9.40E-06 mr1647 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 3.18E-06 3.17E-06 mr1779 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 1.26E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 1.26E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 6.10E-07 mr1811 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 2.55E-06 mr1880 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 2.73E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 2.32E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218068686 NA 1.09E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251