Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1217949623:

Variant ID: vg1217949623 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 17949623
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTATTGTTGTTAGATGATAAAACATGATGAATACTTTATGCTGACTTATCTTTTTAATTTTTTTCATAATTTTTTTAAATAAGATGGACGGTTAAA[T/C]
ATTGGACACGGATATCAGGGTTTGTCTTTTTTTTTTTTTTTTTTTTTTGACTGAGGAAGTATGTCCTGTGGTACCCCTGTCGCCGAATCTACGCATCTGC

Reverse complement sequence

GCAGATGCGTAGATTCGGCGACAGGGGTACCACAGGACATACTTCCTCAGTCAAAAAAAAAAAAAAAAAAAAAAGACAAACCCTGATATCCGTGTCCAAT[A/G]
TTTAACCGTCCATCTTATTTAAAAAAATTATGAAAAAAATTAAAAAGATAAGTCAGCATAAAGTATTCATCATGTTTTATCATCTAACAACAATAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 34.70% 2.62% 4.19% NA
All Indica  2759 45.20% 43.70% 4.06% 7.00% NA
All Japonica  1512 84.90% 14.90% 0.20% 0.00% NA
Aus  269 36.40% 61.70% 1.49% 0.37% NA
Indica I  595 79.50% 3.90% 10.59% 6.05% NA
Indica II  465 19.40% 76.60% 0.86% 3.23% NA
Indica III  913 37.50% 52.50% 2.85% 7.23% NA
Indica Intermediate  786 43.60% 44.30% 2.42% 9.67% NA
Temperate Japonica  767 98.40% 1.30% 0.26% 0.00% NA
Tropical Japonica  504 74.40% 25.40% 0.20% 0.00% NA
Japonica Intermediate  241 63.90% 36.10% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 26.00% 1.04% 1.04% NA
Intermediate  90 71.10% 21.10% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1217949623 T -> C LOC_Os12g30000-LOC_Os12g30020 intergenic_region ; MODIFIER silent_mutation Average:86.697; most accessible tissue: Minghui63 panicle, score: 98.402 N N N N
vg1217949623 T -> DEL N N silent_mutation Average:86.697; most accessible tissue: Minghui63 panicle, score: 98.402 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1217949623 T C -0.07 -0.04 -0.02 -0.02 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1217949623 NA 4.96E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 4.06E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 2.84E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 4.01E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 9.71E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 1.26E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 2.65E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 1.68E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 4.22E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 4.71E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 7.41E-07 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 1.75E-06 mr1835 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 3.99E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 9.21E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 7.63E-07 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 1.33E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 3.38E-06 mr1944 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 2.88E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 9.28E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 2.88E-08 mr1958 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 2.44E-10 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 6.92E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1217949623 NA 1.11E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251